ID: 996119909

View in Genome Browser
Species Human (GRCh38)
Location 5:119659761-119659783
Sequence AATAAGAAACAATATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996119907_996119909 15 Left 996119907 5:119659723-119659745 CCATAAATCTGAATCTCAAAATA No data
Right 996119909 5:119659761-119659783 AATAAGAAACAATATGAAGAAGG No data
996119908_996119909 -8 Left 996119908 5:119659746-119659768 CCTTTAAGTTAATGAAATAAGAA No data
Right 996119909 5:119659761-119659783 AATAAGAAACAATATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996119909 Original CRISPR AATAAGAAACAATATGAAGA AGG Intergenic
No off target data available for this crispr