ID: 996124996

View in Genome Browser
Species Human (GRCh38)
Location 5:119715026-119715048
Sequence GGGTACACAAGGTTTACCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996124996_996125001 2 Left 996124996 5:119715026-119715048 CCCATGGTAAACCTTGTGTACCC No data
Right 996125001 5:119715051-119715073 TGTCCCCATGTAATATTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996124996 Original CRISPR GGGTACACAAGGTTTACCAT GGG (reversed) Intergenic
No off target data available for this crispr