ID: 996128268

View in Genome Browser
Species Human (GRCh38)
Location 5:119751524-119751546
Sequence TGGCAAACAGCAGTGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996128268_996128278 23 Left 996128268 5:119751524-119751546 CCATCTGCCACTGCTGTTTGCCA No data
Right 996128278 5:119751570-119751592 TCCATCCCTCCAGATCCGGCAGG No data
996128268_996128280 24 Left 996128268 5:119751524-119751546 CCATCTGCCACTGCTGTTTGCCA No data
Right 996128280 5:119751571-119751593 CCATCCCTCCAGATCCGGCAGGG 0: 14
1: 66
2: 136
3: 139
4: 219
996128268_996128277 19 Left 996128268 5:119751524-119751546 CCATCTGCCACTGCTGTTTGCCA No data
Right 996128277 5:119751566-119751588 GACTTCCATCCCTCCAGATCCGG 0: 29
1: 69
2: 102
3: 85
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996128268 Original CRISPR TGGCAAACAGCAGTGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr