ID: 996133770

View in Genome Browser
Species Human (GRCh38)
Location 5:119813843-119813865
Sequence CCCTTCCCTGATGGATAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996133766_996133770 -10 Left 996133766 5:119813830-119813852 CCATCTTACCATTCCCTTCCCTG No data
Right 996133770 5:119813843-119813865 CCCTTCCCTGATGGATAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996133770 Original CRISPR CCCTTCCCTGATGGATAATT TGG Intergenic
No off target data available for this crispr