ID: 996143371

View in Genome Browser
Species Human (GRCh38)
Location 5:119942676-119942698
Sequence AGCTAGTTAGAGGTGATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996143371_996143375 20 Left 996143371 5:119942676-119942698 CCTTGTATCACCTCTAACTAGCT No data
Right 996143375 5:119942719-119942741 CAGCTTAACAAATATTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996143371 Original CRISPR AGCTAGTTAGAGGTGATACA AGG (reversed) Intergenic
No off target data available for this crispr