ID: 996147758 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:119996389-119996411 |
Sequence | CCTTACTTGAAGATGCTGCA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
996147758_996147761 | -2 | Left | 996147758 | 5:119996389-119996411 | CCTTGCAGCATCTTCAAGTAAGG | No data | ||
Right | 996147761 | 5:119996410-119996432 | GGGCAGAATACCAAGCTTTATGG | No data | ||||
996147758_996147762 | -1 | Left | 996147758 | 5:119996389-119996411 | CCTTGCAGCATCTTCAAGTAAGG | No data | ||
Right | 996147762 | 5:119996411-119996433 | GGCAGAATACCAAGCTTTATGGG | No data | ||||
996147758_996147763 | 2 | Left | 996147758 | 5:119996389-119996411 | CCTTGCAGCATCTTCAAGTAAGG | No data | ||
Right | 996147763 | 5:119996414-119996436 | AGAATACCAAGCTTTATGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
996147758 | Original CRISPR | CCTTACTTGAAGATGCTGCA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |