ID: 996147758

View in Genome Browser
Species Human (GRCh38)
Location 5:119996389-119996411
Sequence CCTTACTTGAAGATGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996147758_996147761 -2 Left 996147758 5:119996389-119996411 CCTTGCAGCATCTTCAAGTAAGG No data
Right 996147761 5:119996410-119996432 GGGCAGAATACCAAGCTTTATGG No data
996147758_996147762 -1 Left 996147758 5:119996389-119996411 CCTTGCAGCATCTTCAAGTAAGG No data
Right 996147762 5:119996411-119996433 GGCAGAATACCAAGCTTTATGGG No data
996147758_996147763 2 Left 996147758 5:119996389-119996411 CCTTGCAGCATCTTCAAGTAAGG No data
Right 996147763 5:119996414-119996436 AGAATACCAAGCTTTATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996147758 Original CRISPR CCTTACTTGAAGATGCTGCA AGG (reversed) Intergenic
No off target data available for this crispr