ID: 996148120

View in Genome Browser
Species Human (GRCh38)
Location 5:120000005-120000027
Sequence AGGGAGAAGGAGATAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996148113_996148120 9 Left 996148113 5:119999973-119999995 CCTTTCTTTGGGGGAATGTGGGG No data
Right 996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996148120 Original CRISPR AGGGAGAAGGAGATAGAGGA AGG Intergenic
No off target data available for this crispr