ID: 996149607

View in Genome Browser
Species Human (GRCh38)
Location 5:120019452-120019474
Sequence TAGAATAATCACAGGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996149607_996149611 -4 Left 996149607 5:120019452-120019474 CCTCCCTGCCTGTGATTATTCTA No data
Right 996149611 5:120019471-120019493 TCTACTTAATTTCATCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996149607 Original CRISPR TAGAATAATCACAGGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr