ID: 996151770

View in Genome Browser
Species Human (GRCh38)
Location 5:120045834-120045856
Sequence TTCTCTTCAAATAAAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996151770_996151775 19 Left 996151770 5:120045834-120045856 CCCTTTGTTTTATTTGAAGAGAA No data
Right 996151775 5:120045876-120045898 TTGCCACTGAAAGAAGTAGGAGG No data
996151770_996151776 20 Left 996151770 5:120045834-120045856 CCCTTTGTTTTATTTGAAGAGAA No data
Right 996151776 5:120045877-120045899 TGCCACTGAAAGAAGTAGGAGGG No data
996151770_996151774 16 Left 996151770 5:120045834-120045856 CCCTTTGTTTTATTTGAAGAGAA No data
Right 996151774 5:120045873-120045895 ATGTTGCCACTGAAAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996151770 Original CRISPR TTCTCTTCAAATAAAACAAA GGG (reversed) Intergenic
No off target data available for this crispr