ID: 996151771

View in Genome Browser
Species Human (GRCh38)
Location 5:120045835-120045857
Sequence TTTCTCTTCAAATAAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996151771_996151776 19 Left 996151771 5:120045835-120045857 CCTTTGTTTTATTTGAAGAGAAA No data
Right 996151776 5:120045877-120045899 TGCCACTGAAAGAAGTAGGAGGG No data
996151771_996151775 18 Left 996151771 5:120045835-120045857 CCTTTGTTTTATTTGAAGAGAAA No data
Right 996151775 5:120045876-120045898 TTGCCACTGAAAGAAGTAGGAGG No data
996151771_996151778 30 Left 996151771 5:120045835-120045857 CCTTTGTTTTATTTGAAGAGAAA No data
Right 996151778 5:120045888-120045910 GAAGTAGGAGGGCATAAATAAGG No data
996151771_996151774 15 Left 996151771 5:120045835-120045857 CCTTTGTTTTATTTGAAGAGAAA No data
Right 996151774 5:120045873-120045895 ATGTTGCCACTGAAAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996151771 Original CRISPR TTTCTCTTCAAATAAAACAA AGG (reversed) Intergenic
No off target data available for this crispr