ID: 996151774

View in Genome Browser
Species Human (GRCh38)
Location 5:120045873-120045895
Sequence ATGTTGCCACTGAAAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996151770_996151774 16 Left 996151770 5:120045834-120045856 CCCTTTGTTTTATTTGAAGAGAA No data
Right 996151774 5:120045873-120045895 ATGTTGCCACTGAAAGAAGTAGG No data
996151771_996151774 15 Left 996151771 5:120045835-120045857 CCTTTGTTTTATTTGAAGAGAAA No data
Right 996151774 5:120045873-120045895 ATGTTGCCACTGAAAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996151774 Original CRISPR ATGTTGCCACTGAAAGAAGT AGG Intergenic
No off target data available for this crispr