ID: 996153299

View in Genome Browser
Species Human (GRCh38)
Location 5:120066419-120066441
Sequence TGGGAAAGCTTGGGAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996153299_996153304 20 Left 996153299 5:120066419-120066441 CCATTTTTTCCCAAGCTTTCCCA No data
Right 996153304 5:120066462-120066484 AGCTGCTATGAAAATTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996153299 Original CRISPR TGGGAAAGCTTGGGAAAAAA TGG (reversed) Intergenic
No off target data available for this crispr