ID: 996154384

View in Genome Browser
Species Human (GRCh38)
Location 5:120080002-120080024
Sequence CAGGAAAGGCACAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996154377_996154384 11 Left 996154377 5:120079968-120079990 CCAAGTTAAAATATTTTTACTTA No data
Right 996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG No data
996154376_996154384 23 Left 996154376 5:120079956-120079978 CCATGATAGGAACCAAGTTAAAA No data
Right 996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996154384 Original CRISPR CAGGAAAGGCACAATGAGGA GGG Intergenic
No off target data available for this crispr