ID: 996164575

View in Genome Browser
Species Human (GRCh38)
Location 5:120209385-120209407
Sequence CAACAGAGTGAGACTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996164571_996164575 28 Left 996164571 5:120209334-120209356 CCTGGGAGCTGGAGGTTGCAGTG 0: 299
1: 35072
2: 103995
3: 196889
4: 201416
Right 996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996164575 Original CRISPR CAACAGAGTGAGACTGTGCC TGG Intergenic
No off target data available for this crispr