ID: 996164955

View in Genome Browser
Species Human (GRCh38)
Location 5:120212499-120212521
Sequence GACAGCTTTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996164955_996164959 16 Left 996164955 5:120212499-120212521 CCAGTAACAGGCCAAAAGCTGTC No data
Right 996164959 5:120212538-120212560 GTTATCTGCAGAAGATCTCAGGG No data
996164955_996164958 15 Left 996164955 5:120212499-120212521 CCAGTAACAGGCCAAAAGCTGTC No data
Right 996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996164955 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr