ID: 996164958

View in Genome Browser
Species Human (GRCh38)
Location 5:120212537-120212559
Sequence AGTTATCTGCAGAAGATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996164955_996164958 15 Left 996164955 5:120212499-120212521 CCAGTAACAGGCCAAAAGCTGTC No data
Right 996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG No data
996164957_996164958 4 Left 996164957 5:120212510-120212532 CCAAAAGCTGTCTCGCAAAAGGA No data
Right 996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG No data
996164953_996164958 22 Left 996164953 5:120212492-120212514 CCAAAGCCCAGTAACAGGCCAAA No data
Right 996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG No data
996164954_996164958 16 Left 996164954 5:120212498-120212520 CCCAGTAACAGGCCAAAAGCTGT No data
Right 996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996164958 Original CRISPR AGTTATCTGCAGAAGATCTC AGG Intergenic
No off target data available for this crispr