ID: 996165281

View in Genome Browser
Species Human (GRCh38)
Location 5:120215084-120215106
Sequence AGCCTTGCCACCTTTGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996165281_996165287 2 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165287 5:120215109-120215131 TGGCAGCCTGGGATCAGGAAGGG No data
996165281_996165290 19 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165290 5:120215126-120215148 GAAGGGGATATTGCCACTACTGG No data
996165281_996165294 27 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165294 5:120215134-120215156 TATTGCCACTACTGGGTGTGGGG No data
996165281_996165288 3 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165288 5:120215110-120215132 GGCAGCCTGGGATCAGGAAGGGG No data
996165281_996165285 -3 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165285 5:120215104-120215126 GCTGATGGCAGCCTGGGATCAGG No data
996165281_996165283 -10 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165283 5:120215097-120215119 TGGCAAGGCTGATGGCAGCCTGG No data
996165281_996165291 20 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165291 5:120215127-120215149 AAGGGGATATTGCCACTACTGGG No data
996165281_996165292 25 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165292 5:120215132-120215154 GATATTGCCACTACTGGGTGTGG No data
996165281_996165284 -9 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165284 5:120215098-120215120 GGCAAGGCTGATGGCAGCCTGGG No data
996165281_996165286 1 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165286 5:120215108-120215130 ATGGCAGCCTGGGATCAGGAAGG No data
996165281_996165293 26 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165293 5:120215133-120215155 ATATTGCCACTACTGGGTGTGGG No data
996165281_996165295 30 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165295 5:120215137-120215159 TGCCACTACTGGGTGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996165281 Original CRISPR AGCCTTGCCACCTTTGTCTG AGG (reversed) Intergenic
No off target data available for this crispr