ID: 996165289

View in Genome Browser
Species Human (GRCh38)
Location 5:120215115-120215137
Sequence AATATCCCCTTCCTGATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996165289_996165297 12 Left 996165289 5:120215115-120215137 CCTGGGATCAGGAAGGGGATATT No data
Right 996165297 5:120215150-120215172 TGTGGGGAGGCCATTTCCTCTGG No data
996165289_996165298 21 Left 996165289 5:120215115-120215137 CCTGGGATCAGGAAGGGGATATT No data
Right 996165298 5:120215159-120215181 GCCATTTCCTCTGGCAAAAAAGG 0: 2
1: 3
2: 14
3: 71
4: 308
996165289_996165293 -5 Left 996165289 5:120215115-120215137 CCTGGGATCAGGAAGGGGATATT No data
Right 996165293 5:120215133-120215155 ATATTGCCACTACTGGGTGTGGG No data
996165289_996165295 -1 Left 996165289 5:120215115-120215137 CCTGGGATCAGGAAGGGGATATT No data
Right 996165295 5:120215137-120215159 TGCCACTACTGGGTGTGGGGAGG No data
996165289_996165294 -4 Left 996165289 5:120215115-120215137 CCTGGGATCAGGAAGGGGATATT No data
Right 996165294 5:120215134-120215156 TATTGCCACTACTGGGTGTGGGG No data
996165289_996165292 -6 Left 996165289 5:120215115-120215137 CCTGGGATCAGGAAGGGGATATT No data
Right 996165292 5:120215132-120215154 GATATTGCCACTACTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996165289 Original CRISPR AATATCCCCTTCCTGATCCC AGG (reversed) Intergenic
No off target data available for this crispr