ID: 996165292

View in Genome Browser
Species Human (GRCh38)
Location 5:120215132-120215154
Sequence GATATTGCCACTACTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996165281_996165292 25 Left 996165281 5:120215084-120215106 CCTCAGACAAAGGTGGCAAGGCT No data
Right 996165292 5:120215132-120215154 GATATTGCCACTACTGGGTGTGG No data
996165289_996165292 -6 Left 996165289 5:120215115-120215137 CCTGGGATCAGGAAGGGGATATT No data
Right 996165292 5:120215132-120215154 GATATTGCCACTACTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996165292 Original CRISPR GATATTGCCACTACTGGGTG TGG Intergenic
No off target data available for this crispr