ID: 996169135

View in Genome Browser
Species Human (GRCh38)
Location 5:120267003-120267025
Sequence TGATCTTACTCTTACCATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996169135_996169142 21 Left 996169135 5:120267003-120267025 CCGTAATGGTAAGAGTAAGATCA No data
Right 996169142 5:120267047-120267069 AGGGGTTTACACTTTTACTAAGG No data
996169135_996169139 2 Left 996169135 5:120267003-120267025 CCGTAATGGTAAGAGTAAGATCA No data
Right 996169139 5:120267028-120267050 GGCATAGAAGACCACATTAAGGG No data
996169135_996169138 1 Left 996169135 5:120267003-120267025 CCGTAATGGTAAGAGTAAGATCA No data
Right 996169138 5:120267027-120267049 GGGCATAGAAGACCACATTAAGG No data
996169135_996169140 3 Left 996169135 5:120267003-120267025 CCGTAATGGTAAGAGTAAGATCA No data
Right 996169140 5:120267029-120267051 GCATAGAAGACCACATTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996169135 Original CRISPR TGATCTTACTCTTACCATTA CGG (reversed) Intergenic
No off target data available for this crispr