ID: 996169142

View in Genome Browser
Species Human (GRCh38)
Location 5:120267047-120267069
Sequence AGGGGTTTACACTTTTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996169135_996169142 21 Left 996169135 5:120267003-120267025 CCGTAATGGTAAGAGTAAGATCA No data
Right 996169142 5:120267047-120267069 AGGGGTTTACACTTTTACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996169142 Original CRISPR AGGGGTTTACACTTTTACTA AGG Intergenic
No off target data available for this crispr