ID: 996176501

View in Genome Browser
Species Human (GRCh38)
Location 5:120365952-120365974
Sequence AGGTGTGGCAGCTGAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996176492_996176501 27 Left 996176492 5:120365902-120365924 CCACCCAATCACTGAGATGATGA No data
Right 996176501 5:120365952-120365974 AGGTGTGGCAGCTGAGGAGATGG No data
996176497_996176501 -2 Left 996176497 5:120365931-120365953 CCAAGGAAGAAGGCTTTAATCAG 0: 57
1: 105
2: 174
3: 232
4: 367
Right 996176501 5:120365952-120365974 AGGTGTGGCAGCTGAGGAGATGG No data
996176494_996176501 23 Left 996176494 5:120365906-120365928 CCAATCACTGAGATGATGAGTAT No data
Right 996176501 5:120365952-120365974 AGGTGTGGCAGCTGAGGAGATGG No data
996176493_996176501 24 Left 996176493 5:120365905-120365927 CCCAATCACTGAGATGATGAGTA No data
Right 996176501 5:120365952-120365974 AGGTGTGGCAGCTGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996176501 Original CRISPR AGGTGTGGCAGCTGAGGAGA TGG Intergenic
No off target data available for this crispr