ID: 996183808

View in Genome Browser
Species Human (GRCh38)
Location 5:120451997-120452019
Sequence AGAAGAATGTGCAAAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996183808_996183812 19 Left 996183808 5:120451997-120452019 CCTTGTTCTTTGCACATTCTTCT No data
Right 996183812 5:120452039-120452061 TAGTACATAACCAATAAGGCAGG No data
996183808_996183813 23 Left 996183808 5:120451997-120452019 CCTTGTTCTTTGCACATTCTTCT No data
Right 996183813 5:120452043-120452065 ACATAACCAATAAGGCAGGTTGG No data
996183808_996183814 24 Left 996183808 5:120451997-120452019 CCTTGTTCTTTGCACATTCTTCT No data
Right 996183814 5:120452044-120452066 CATAACCAATAAGGCAGGTTGGG No data
996183808_996183811 15 Left 996183808 5:120451997-120452019 CCTTGTTCTTTGCACATTCTTCT No data
Right 996183811 5:120452035-120452057 ACTTTAGTACATAACCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996183808 Original CRISPR AGAAGAATGTGCAAAGAACA AGG (reversed) Intergenic
No off target data available for this crispr