ID: 996183811

View in Genome Browser
Species Human (GRCh38)
Location 5:120452035-120452057
Sequence ACTTTAGTACATAACCAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996183808_996183811 15 Left 996183808 5:120451997-120452019 CCTTGTTCTTTGCACATTCTTCT No data
Right 996183811 5:120452035-120452057 ACTTTAGTACATAACCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996183811 Original CRISPR ACTTTAGTACATAACCAATA AGG Intergenic
No off target data available for this crispr