ID: 996184203

View in Genome Browser
Species Human (GRCh38)
Location 5:120456880-120456902
Sequence CTGTGTAAGGCTAAAGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996184203_996184205 0 Left 996184203 5:120456880-120456902 CCTTACACTTTAGCCTTACACAG No data
Right 996184205 5:120456903-120456925 AATGCCCTTACGTACTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996184203 Original CRISPR CTGTGTAAGGCTAAAGTGTA AGG (reversed) Intergenic
No off target data available for this crispr