ID: 996189292

View in Genome Browser
Species Human (GRCh38)
Location 5:120518839-120518861
Sequence TAGATTATGAATGTCATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 187}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996189283_996189292 7 Left 996189283 5:120518809-120518831 CCCCTTGCCTCTTTTCCCCTTCT 0: 1
1: 0
2: 14
3: 168
4: 1318
Right 996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG 0: 1
1: 0
2: 4
3: 14
4: 187
996189289_996189292 -9 Left 996189289 5:120518825-120518847 CCCTTCTTGCTGGCTAGATTATG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG 0: 1
1: 0
2: 4
3: 14
4: 187
996189287_996189292 0 Left 996189287 5:120518816-120518838 CCTCTTTTCCCCTTCTTGCTGGC 0: 1
1: 0
2: 5
3: 51
4: 488
Right 996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG 0: 1
1: 0
2: 4
3: 14
4: 187
996189288_996189292 -8 Left 996189288 5:120518824-120518846 CCCCTTCTTGCTGGCTAGATTAT 0: 1
1: 0
2: 0
3: 22
4: 181
Right 996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG 0: 1
1: 0
2: 4
3: 14
4: 187
996189290_996189292 -10 Left 996189290 5:120518826-120518848 CCTTCTTGCTGGCTAGATTATGA 0: 1
1: 0
2: 2
3: 21
4: 130
Right 996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG 0: 1
1: 0
2: 4
3: 14
4: 187
996189284_996189292 6 Left 996189284 5:120518810-120518832 CCCTTGCCTCTTTTCCCCTTCTT 0: 1
1: 0
2: 8
3: 167
4: 1399
Right 996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG 0: 1
1: 0
2: 4
3: 14
4: 187
996189285_996189292 5 Left 996189285 5:120518811-120518833 CCTTGCCTCTTTTCCCCTTCTTG 0: 1
1: 0
2: 10
3: 116
4: 962
Right 996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG 0: 1
1: 0
2: 4
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996189292 Original CRISPR TAGATTATGAATGTCATGGC TGG Intronic
900609287 1:3537670-3537692 TTGCTTTTAAATGTCATGGCCGG - Intronic
902962751 1:19976433-19976455 TGGATTCTTAATGACATGGCTGG + Intronic
903104222 1:21061088-21061110 TAGATTATGGATATCAGGGATGG + Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905454308 1:38077179-38077201 TAGAGTTTGAATGGCAGGGCAGG - Intergenic
905931541 1:41791498-41791520 TATATAATGGATGTGATGGCTGG + Intronic
906064564 1:42971151-42971173 TAGATTATCCATGTCAGGCCGGG + Intergenic
909046944 1:70721736-70721758 TACATTATAAATTTCATAGCTGG - Intergenic
913361475 1:117985434-117985456 TGAAATATGAATGTAATGGCTGG + Intronic
916142977 1:161715628-161715650 TAAAGGATGAATGTCATGTCTGG + Intergenic
916491302 1:165304736-165304758 TAGATTATGAAGGTCCAGACAGG - Intronic
917510251 1:175663674-175663696 TAGATTATGGATCTCAAGCCTGG + Intronic
918489870 1:185070158-185070180 TAGTTTATGATTGTCATGTATGG + Intronic
920130968 1:203731554-203731576 CAGAAAATGAATGGCATGGCCGG + Intronic
922365323 1:224857913-224857935 TAGAGTATGGATGTTATGGCTGG + Intergenic
923291948 1:232554016-232554038 TAGTTTATAAATGTCCTGGATGG - Intronic
923818666 1:237409583-237409605 TATATTATAAATGTCATAACAGG - Intronic
924734326 1:246741768-246741790 TACATAATAAATGTCAGGGCTGG + Intronic
1062944562 10:1450671-1450693 TTTATTCTGAAGGTCATGGCAGG + Intronic
1063244265 10:4202192-4202214 TAAATGATGAATGTCATGGTAGG + Intergenic
1064110400 10:12533924-12533946 TGGAATAAGAATGTGATGGCTGG - Intronic
1064605762 10:17036963-17036985 AAGATTATAAGTGTCAAGGCCGG - Intronic
1065023667 10:21521292-21521314 TAGATTATTAATGTGAAAGCTGG + Intronic
1065631665 10:27686810-27686832 CAGAATATGGAAGTCATGGCTGG - Intronic
1067429771 10:46235376-46235398 TGGAGTATGAGTGTGATGGCTGG + Intergenic
1069258227 10:66361263-66361285 AACATTATGAATTTGATGGCTGG - Intronic
1070187558 10:74080182-74080204 TAGATTATGAATTTGATTTCTGG + Intronic
1073759264 10:106612483-106612505 TATATCATGAATGACATGCCTGG - Intronic
1073825799 10:107319584-107319606 AAGATTTTGAATGTCATGAAAGG - Intergenic
1074422025 10:113317425-113317447 TAGAGTATGAATGTTCAGGCAGG - Intergenic
1074852485 10:117449827-117449849 TAGAATGTGAATGTGATGTCTGG - Intergenic
1074950564 10:118330393-118330415 TAGATTATGATCTTAATGGCTGG - Intronic
1075611360 10:123857361-123857383 TAGATTTTGAATGGGCTGGCTGG - Intronic
1075884568 10:125887127-125887149 TAGATTATGAATGATATCGATGG - Intronic
1075957076 10:126533342-126533364 TAAAATATGTATGACATGGCTGG - Intronic
1076129736 10:128005448-128005470 CAGACTATGAATTTCCTGGCTGG - Intronic
1083676335 11:64327512-64327534 TGGACGATGAATGTGATGGCTGG - Intergenic
1084749961 11:71198262-71198284 TATGTTATGAATGTTGTGGCTGG + Intronic
1086855999 11:91866805-91866827 TAGGGTATGAACTTCATGGCGGG + Intergenic
1088323258 11:108574879-108574901 TCGAATATGAATGTGATGTCTGG + Intronic
1089212102 11:116811537-116811559 TTGACTATGAATGTCACTGCAGG - Intergenic
1090767218 11:129886730-129886752 CAGATGAGGAATGTCAAGGCAGG - Intronic
1091561512 12:1617798-1617820 TGGAATATGAATGTCTTGGTGGG - Intronic
1092910834 12:13143700-13143722 TAGAATGTGGATGTGATGGCTGG - Intergenic
1094137240 12:27141049-27141071 TAGATAATGTATGTAATGCCCGG - Intergenic
1097992925 12:65855208-65855230 TAGATTTTAAATGTCCTTGCGGG + Intronic
1098641899 12:72848919-72848941 AAAATCATTAATGTCATGGCTGG - Intergenic
1099924107 12:88996516-88996538 TGGAATATGAATGTGATGGCTGG + Intergenic
1100117352 12:91323500-91323522 TGAATTATGAATGTTATGGATGG + Intergenic
1101034872 12:100695278-100695300 TAGATTATTAGTTTCTTGGCCGG - Intergenic
1104385846 12:128350927-128350949 TGGAATATGAATATAATGGCAGG + Intronic
1104635155 12:130433949-130433971 CAGATGAAGAACGTCATGGCCGG + Intronic
1105636372 13:22219692-22219714 TAGATGATGAACGTCAGGGAAGG + Intergenic
1106048902 13:26172194-26172216 TAAGTGATGAATGCCATGGCAGG + Intronic
1106879956 13:34118242-34118264 TGGAATGTGAATGTGATGGCAGG - Intergenic
1107179713 13:37444776-37444798 TAGATCATGAATGTGATGAATGG - Intergenic
1108726510 13:53188686-53188708 TGGATTGTGAATGTGATGGCTGG + Intergenic
1109481946 13:62966385-62966407 TAGATTATGAATGTTATGGTGGG + Intergenic
1110750714 13:79112020-79112042 TAGGTGATGAAGGTGATGGCTGG - Intergenic
1111070914 13:83167064-83167086 TAGAGAATGACTGTCTTGGCAGG - Intergenic
1112509972 13:100000199-100000221 TACATTAAGAATGTTGTGGCCGG - Intergenic
1113201593 13:107872358-107872380 TAGATTTTTAATGTCATGTGGGG - Intergenic
1114413165 14:22519178-22519200 TAGATTTTGAAACTCAGGGCGGG + Intergenic
1114544822 14:23491570-23491592 TATATTATTAATCTCATGGTTGG - Intronic
1118458903 14:65970407-65970429 CAGTTAATGAATGTCATGTCAGG - Intronic
1120105618 14:80490843-80490865 TATAAAATGAATGTCAAGGCAGG + Intronic
1120574082 14:86159102-86159124 CAGATTATGTATGTCAGGACGGG + Intergenic
1125298145 15:38224616-38224638 AAGATTACCAATGTCATGACAGG - Intergenic
1125548210 15:40524451-40524473 AAGATTATGCATGTTGTGGCTGG - Intergenic
1126008607 15:44281868-44281890 TGCATCAAGAATGTCATGGCTGG + Intergenic
1126767829 15:52026753-52026775 TAGAAAATGCCTGTCATGGCTGG + Intronic
1127647017 15:60968945-60968967 AAGGTTATGAATGTCAAGGGAGG - Intronic
1128320301 15:66688876-66688898 TAGGTTATAGATGTGATGGCTGG - Intergenic
1128644087 15:69362131-69362153 GAGATTCTGAATGTCAGGGCTGG + Intronic
1128789372 15:70421948-70421970 TGGATTCTGAATGTAGTGGCTGG - Intergenic
1129615505 15:77096495-77096517 CAGATTATGAATGTCAAGAAGGG + Intergenic
1130317029 15:82805005-82805027 TCCATTATGAATGTCTTTGCTGG + Intronic
1131313855 15:91315202-91315224 TTGATTATGTATGACATGTCAGG - Intergenic
1131972674 15:97907752-97907774 TGGATCATGGATGTAATGGCTGG + Intergenic
1133037734 16:3043776-3043798 TAAATTAGGAAAGTCCTGGCTGG + Intergenic
1133410594 16:5565327-5565349 TAGAATTTGCAAGTCATGGCCGG + Intergenic
1135188818 16:20337782-20337804 TAATTTTTGAATGTCATTGCTGG - Intronic
1141760899 16:86027913-86027935 TAGAATGTGAATGTGATGGCTGG + Intergenic
1143804005 17:9410364-9410386 TAGATAATGAATGTTAAGGAAGG - Intronic
1145356842 17:22166367-22166389 TAGATTATGAATGTTATGGTGGG - Intergenic
1148037943 17:44682559-44682581 TAGATTAAGAATATTTTGGCCGG + Intronic
1149838301 17:59934715-59934737 TAAATGATCTATGTCATGGCAGG + Intronic
1152171514 17:78752926-78752948 AAGATTATGAATGTCTTGGCAGG - Intronic
1152988363 18:339896-339918 TAGATTATTAATGCCAGGGTTGG + Intronic
1154371967 18:13772102-13772124 TAGATTAAGAATGGAATTGCAGG + Intergenic
1155750659 18:29419186-29419208 TAGTGTATGAATGTGATGGCTGG - Intergenic
1157306790 18:46523323-46523345 TGGAATATGGATGTGATGGCTGG + Intronic
1157441226 18:47713226-47713248 TAGATTATGTATTTCCTGGTAGG + Intergenic
1158346115 18:56518819-56518841 GAGATTTTCAATGTCCTGGCCGG + Intergenic
1159052262 18:63432214-63432236 AAGAATATAACTGTCATGGCTGG + Intergenic
1160771341 19:832625-832647 TAAAATATGAATATGATGGCTGG + Intergenic
1164887165 19:31789399-31789421 TATATTATTATTGGCATGGCTGG - Intergenic
927039634 2:19215396-19215418 TAAATTATGAATTCCAGGGCAGG + Intergenic
928038645 2:27851347-27851369 TTGATTAGGAATGTCATAGGAGG - Intronic
930280776 2:49367355-49367377 TAGATTATTAGTTTCATGTCTGG - Intergenic
932583907 2:73010376-73010398 TGGAATGTGAATGTGATGGCTGG + Intronic
933516762 2:83313624-83313646 TAGATTATAAATTTACTGGCAGG - Intergenic
933549391 2:83756144-83756166 TAGACTATTAATGTCAAGGGAGG - Intergenic
934692936 2:96375806-96375828 TAGACTATGGATGTGATGGCTGG - Intergenic
934864749 2:97797687-97797709 TAGAATATGAATCTCATCGTTGG - Intronic
935891594 2:107684803-107684825 TAGATCTTGAATGTCATGAATGG - Intergenic
937276457 2:120687400-120687422 TAGAATGTGGATGTGATGGCTGG - Intergenic
938418727 2:131126057-131126079 TAGATTATGAACCACATGGTCGG + Intronic
942939557 2:181600075-181600097 CAGATTATGAAATTCTTGGCTGG - Intronic
943981437 2:194556690-194556712 TAGATCATGAATATCAGGGAAGG - Intergenic
944572710 2:201060488-201060510 TAGAACATAAATGTGATGGCTGG + Intronic
944995390 2:205288130-205288152 TTCATTGTGACTGTCATGGCCGG - Intronic
947995076 2:234520714-234520736 TAGATCATGAATGTATTGACTGG + Intergenic
1169282966 20:4282754-4282776 TGGAATATGGATGTGATGGCTGG - Intergenic
1172012695 20:31855475-31855497 TAGATCATGAATGTCCTTGAAGG + Intronic
1173644666 20:44625961-44625983 TAGAATGTGAACATCATGGCAGG - Intronic
1174170835 20:48617305-48617327 TAGATTATGCATCGTATGGCCGG - Intergenic
1174375251 20:50122404-50122426 TAAAAAATAAATGTCATGGCTGG + Intronic
1175767087 20:61599214-61599236 GAGATGGTGAATGGCATGGCAGG - Intronic
1176886328 21:14259745-14259767 AAGAAAATGAATGTTATGGCTGG + Intergenic
1177891242 21:26806560-26806582 TAGAATGAGAATGTGATGGCTGG - Intergenic
1179244550 21:39620116-39620138 AAGATTAGGAATATTATGGCCGG - Intronic
1179264844 21:39794232-39794254 TAGATAAGGAATGTTATGGGTGG + Intronic
1179532701 21:42030964-42030986 TGGAATATGTATGTCATAGCTGG + Intergenic
1182311110 22:29408111-29408133 TAGATGATCAATGTAGTGGCAGG + Intronic
1182689996 22:32152998-32153020 TAGATGATCAATGTAGTGGCAGG - Intronic
1184582545 22:45427314-45427336 TGGACTATGCATGTGATGGCTGG - Intronic
949435052 3:4020127-4020149 GTGATTATGAATGTCATATCTGG + Intronic
950964272 3:17135440-17135462 TAAAATATGGATGTGATGGCTGG + Intergenic
955497858 3:59554906-59554928 TAGTTTATGAACATCATGCCTGG - Intergenic
959916396 3:111821204-111821226 TAGATTTTGAATGTCTTTTCTGG + Intronic
960287856 3:115849612-115849634 TAAATAATGGATTTCATGGCCGG + Intronic
962741449 3:138365261-138365283 TGAATTATAATTGTCATGGCAGG + Intronic
964946441 3:162231382-162231404 TAGGTTATAAATGACATGGCTGG - Intergenic
966374358 3:179280397-179280419 AGGAATATAAATGTCATGGCAGG - Intergenic
971208460 4:24592652-24592674 AAGGTTATGAATGTCAGGGTGGG + Intergenic
971908937 4:32768877-32768899 TTCATTATGTATGTCATGGTGGG + Intergenic
973632147 4:52829630-52829652 TGGAATGTGAATGTAATGGCTGG + Intergenic
976872138 4:89807912-89807934 AAGATTAGGAATATCAAGGCAGG - Intronic
978093619 4:104747977-104747999 TATATAATGTATGTCATAGCAGG + Intergenic
978470812 4:109065361-109065383 CAGATTATAATTGACATGGCTGG - Intronic
978853294 4:113364063-113364085 TTGTTTATGAATGGCATGGTGGG + Intronic
981059187 4:140402561-140402583 GAGATTATGAATCTCTTTGCTGG - Intronic
981128714 4:141134130-141134152 TTTATTCTGATTGTCATGGCTGG + Intronic
981722147 4:147812431-147812453 TAGAAAATGAATGTGCTGGCTGG - Intronic
982034762 4:151334712-151334734 TAGAATTTGGATGTAATGGCTGG + Intergenic
982088024 4:151855946-151855968 TAAAACATGAATGTAATGGCTGG - Intergenic
982382571 4:154764809-154764831 TAGATCTTGTATCTCATGGCAGG - Intergenic
983111306 4:163753594-163753616 TAGTTCATTAATATCATGGCTGG + Intronic
983388294 4:167094562-167094584 CACATTATGAATATAATGGCTGG - Intronic
986811791 5:11367854-11367876 GACATTATGTCTGTCATGGCAGG - Intronic
988739563 5:34056804-34056826 TAGAATGTAAAAGTCATGGCCGG - Intronic
989042825 5:37247154-37247176 TATATTATGAATGGCATTCCTGG + Intronic
989458511 5:41669343-41669365 TCTTTTATGAATGTCTTGGCAGG + Intergenic
990924999 5:61010917-61010939 TAGAATGTGAATGTGCTGGCTGG + Intronic
993361516 5:86982196-86982218 TGGTGTATGAATGTAATGGCAGG + Intergenic
994002581 5:94797753-94797775 TAGATTATAAATGTGAGGGAAGG - Intronic
995118763 5:108513163-108513185 TAGATCCTGATTGTCTTGGCAGG - Intergenic
995983016 5:118131045-118131067 TGGAAAATGAATGTGATGGCTGG - Intergenic
996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG + Intronic
998372560 5:141671080-141671102 TAGCTGATGACGGTCATGGCTGG - Intronic
998567201 5:143226183-143226205 TAGCTAAAGAATGCCATGGCCGG + Exonic
998603024 5:143604379-143604401 TAGATTCTGTATGGCATTGCTGG + Intergenic
1000286967 5:159835094-159835116 TAGAATATGGATGTGATGGCTGG + Intergenic
1001690288 5:173627954-173627976 TAGCTTTTTAATTTCATGGCTGG - Intergenic
1003242767 6:4358897-4358919 TAGATTATGTGTGTCATGCGAGG + Intergenic
1004474468 6:15958678-15958700 TAGATTAGGGATGTAATGGCTGG - Intergenic
1005433328 6:25781553-25781575 TGGATTGTGATTGTGATGGCTGG + Intergenic
1010288006 6:74101832-74101854 GTGATTATGAATGTGATGGGTGG + Intergenic
1011973704 6:93263513-93263535 TAGCTAAGGAATGTCATGTCAGG - Intronic
1012805946 6:103893014-103893036 TAAATTTAGAAGGTCATGGCTGG + Intergenic
1014815128 6:125927032-125927054 TAGATCATGAATATCATGAAAGG - Intronic
1015535380 6:134262328-134262350 TAGAGTATGCATTACATGGCTGG + Intronic
1016057983 6:139599018-139599040 TAAATTAAGAAACTCATGGCCGG + Intergenic
1016945096 6:149524178-149524200 TAGTGAATGAATGTCATAGCTGG - Intronic
1018143790 6:160864384-160864406 TAGATTAGGGAGGACATGGCGGG - Intergenic
1019980701 7:4619870-4619892 TGGAATATGGATGTGATGGCTGG + Intergenic
1028944738 7:96564571-96564593 TAGAAAGTGAATGTGATGGCTGG + Intronic
1029885561 7:103866866-103866888 TAGAGTATGTATGTCAGGGTAGG - Intronic
1030740258 7:113101092-113101114 CAGATCATGTAGGTCATGGCAGG - Intergenic
1031989940 7:128190935-128190957 TGGATTGTGAATGGCAGGGCAGG - Intergenic
1036135826 8:6160728-6160750 TAGATTATGTATGACAGGACAGG + Intergenic
1037195964 8:16190191-16190213 TAAATTATGAAAATAATGGCCGG - Intronic
1037672644 8:21028546-21028568 TCGAATGTGAATGTCCTGGCAGG + Intergenic
1039758996 8:40553703-40553725 TAGATAATGAATGATATGGATGG + Intronic
1042009591 8:64226847-64226869 TAGATTATGAATGTTATGTCAGG + Intergenic
1046787637 8:118285178-118285200 TAGATTATGCATTACATGGGTGG + Intronic
1054962194 9:70981332-70981354 TAAATTATGAATATGATGTCTGG + Intronic
1056686862 9:88773494-88773516 TAGATTATCTATGTCATTTCGGG - Intergenic
1057671854 9:97097657-97097679 TAGATTATGAAAAACTTGGCAGG - Intergenic
1058427114 9:104884735-104884757 TAGATTAAGAATGGCATGTGAGG - Intronic
1059771673 9:117432432-117432454 TAGATCATGCATGTGATGGCTGG - Intergenic
1062166800 9:135112009-135112031 AAGGTTAAGAATGTCCTGGCTGG - Intronic
1186161772 X:6784399-6784421 TAGATCCTGGATGTCAGGGCTGG + Intergenic
1186363938 X:8872345-8872367 TAGGATATGAATATCTTGGCAGG - Intergenic
1187507581 X:19889134-19889156 GAGATTAAGAATGTGAAGGCCGG + Intergenic
1190817614 X:53942182-53942204 AAGATCATGAATGTCAGGCCAGG - Intronic
1191026981 X:55924371-55924393 TTAATTAAGAATGTCAGGGCCGG - Intergenic
1191665632 X:63699620-63699642 TATATTATGTATGTTATGGCAGG + Intronic
1192056950 X:67782894-67782916 CTGAATATGAATGTCATGACTGG - Intergenic
1192404405 X:70869859-70869881 TGGATTATGAATGTCAGGATTGG - Intronic
1193526791 X:82600240-82600262 TAGAATATGAAATTCTTGGCTGG - Intergenic
1199468271 X:148164849-148164871 CAGAATATGAATGTCATGCCTGG - Intergenic
1200142640 X:153909644-153909666 TAGATTCTGAAGGTCTGGGCTGG - Intronic
1200803250 Y:7405951-7405973 TAGAATATGAAGGTCATCTCAGG + Intergenic
1201731081 Y:17203945-17203967 TAGATTATAATTGTCAGGGATGG + Intergenic