ID: 996190474

View in Genome Browser
Species Human (GRCh38)
Location 5:120534643-120534665
Sequence CAACTTATGCTGAGTGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996190474 Original CRISPR CAACTTATGCTGAGTGTGTA AGG (reversed) Intronic
901852979 1:12027894-12027916 CAACTTATGTTGGGTGTATCAGG - Intronic
902951265 1:19884390-19884412 AAAAGTATGCTGTGTGTGTATGG - Intronic
907197933 1:52702251-52702273 CAAATTATGGTGAGGATGTAGGG - Intergenic
907575576 1:55522925-55522947 CAGCTCATGCTGAGGTTGTAGGG - Intergenic
910321328 1:85948087-85948109 CAACTTATTCTTACTTTGTAAGG + Intronic
911835467 1:102613788-102613810 AAACTTATGCAGAGAGAGTATGG + Intergenic
919343245 1:196341125-196341147 CAACTTATGCTGGGTTTATCAGG - Intronic
924150204 1:241122319-241122341 CAACTTATGATGAGTTTATCAGG - Intronic
1063496299 10:6512260-6512282 CAGCTTTTGCTGAGGGTGCATGG - Intronic
1064530597 10:16305192-16305214 CAACTTATGATGGGTTTATAAGG + Intergenic
1069881200 10:71594774-71594796 TAACTGATGCAGAGTGTGTGGGG - Intronic
1070950387 10:80426496-80426518 CAACTTATGATGGGTTTGTAGGG + Intronic
1072839014 10:98749839-98749861 CAACTTATGATGAGTTTATTGGG + Intronic
1075466835 10:122657812-122657834 CAACTTAGGCTGAGATTCTACGG + Intergenic
1077993753 11:7435055-7435077 CTTCTTATCCTGAGAGTGTAGGG - Intronic
1078872279 11:15359415-15359437 CTAGTTATACTGAGTTTGTATGG + Intergenic
1080077100 11:28162570-28162592 CAACTTATGATGATTTTATAAGG - Intronic
1086253241 11:84842890-84842912 CAATTTTTGCTGTGTGTGTTGGG - Intronic
1089231377 11:116980120-116980142 CAACTTATGATGGGTTTATAAGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090631919 11:128657045-128657067 CAACTTGTACTGACTGGGTAGGG - Intergenic
1091708978 12:2723924-2723946 CAGCTTAGGATGAGTGTGGAAGG + Intergenic
1091794593 12:3290738-3290760 CAACTTATGATGAGTTTATTGGG + Intergenic
1094229256 12:28084020-28084042 GAACTTATGCTTAGTGACTAGGG + Intergenic
1094443090 12:30500984-30501006 CATCTGCTGCTGAGTGTGTATGG - Intergenic
1098861377 12:75714624-75714646 CAACTCATGCTTTGTGTGAATGG + Intergenic
1102384347 12:112495027-112495049 CAACTTATGATGAGTTTATTGGG + Intronic
1102854214 12:116278571-116278593 CAACATTTCCTGAGTGTATATGG + Intergenic
1104480416 12:129103093-129103115 AAACATATGCTGATTTTGTAGGG - Intronic
1104715202 12:131011655-131011677 CAAATCATGCTGCGTGTTTAGGG + Intronic
1105067355 12:133212293-133212315 GAAATTATGCTGGGTGTGTGTGG + Intergenic
1106853615 13:33822042-33822064 AATCATATGCTGAGTGTGGATGG + Intronic
1110517034 13:76425585-76425607 TAACTTATTCTGAGTTTGTTGGG + Intergenic
1112306625 13:98280274-98280296 CAGCTGATGCTGGGTGTGGAGGG - Intronic
1112308110 13:98293649-98293671 CAACTTATCCTGAATGTGTGTGG + Intronic
1112852419 13:103723011-103723033 CAACTTATGCCGTGAGTGAAAGG + Intergenic
1113454394 13:110437877-110437899 CAATTTATGATGATTGTGTGAGG + Intronic
1113504760 13:110807760-110807782 CAACTTGGGCTGTCTGTGTATGG - Intergenic
1117582151 14:57162299-57162321 GAAATTATTCTGAGTGTGTGGGG - Intergenic
1126647004 15:50884557-50884579 CAACTTATGATGAGTTTTTTGGG + Intergenic
1133464962 16:6019893-6019915 CAGCTTATGGTGAGTGTGGCTGG + Intronic
1136006771 16:27336087-27336109 CAACTTATGATGAGTTTATGGGG - Intronic
1137023537 16:35452626-35452648 CAGCTTATTCTGTGTGTGGAAGG - Intergenic
1138270626 16:55693390-55693412 CAGCTTAGTCTGAGTGTGTGAGG + Intronic
1143103534 17:4516854-4516876 CAAGTGATGCAGAGTGTTTAGGG + Intronic
1146292859 17:31623561-31623583 CAACTTATGATGGGTGTATCAGG - Intergenic
1150096926 17:62385048-62385070 CAACTTATGATGGGTTTATAAGG + Intronic
1150267619 17:63841586-63841608 CGACTTCTGCTCAGTGTGTGAGG - Intronic
1150516691 17:65819364-65819386 TAAGTTATGCTGAGGGTGTGGGG - Intronic
1152292905 17:79450608-79450630 CAACTTATGGTGGGTTTGTTGGG + Intronic
1154050316 18:10949678-10949700 CAGCTTATGCAGAGTATCTAAGG + Intronic
1156664071 18:39383855-39383877 CATTTGATGCTGAGAGTGTATGG + Intergenic
1156807338 18:41201356-41201378 CAACTTATGTTGGGTTTATAAGG - Intergenic
1157538909 18:48485037-48485059 CATCTTATGTTGGGTGTGTGGGG + Intergenic
1160235150 18:77079777-77079799 GAATTTATTCTGAGTGTGGAAGG - Intronic
1164064853 19:21707015-21707037 CCACTTATCAGGAGTGTGTAAGG + Intergenic
1168436136 19:56318814-56318836 CAATTTATACTGAGTGTATTAGG - Intronic
926243109 2:11103207-11103229 GAGCCTATGCTGAGTGTGTGTGG + Intergenic
926885503 2:17594762-17594784 CAAGTTCTGATGAGTGTTTAAGG + Intronic
929124838 2:38513617-38513639 AAACTTTTTCTGAGTGTGTTTGG + Intergenic
931914742 2:66941755-66941777 TCTTTTATGCTGAGTGTGTAGGG - Intergenic
933431149 2:82181344-82181366 CAACTTATGATGAGTTTATCTGG + Intergenic
933526879 2:83452718-83452740 CAACTTATGATGAGTTTATCAGG - Intergenic
933589551 2:84216816-84216838 CAACTTCTGTTGAGTGTATTAGG - Intergenic
938974955 2:136467958-136467980 CAACTTATGATGAGTTTTTTGGG + Intergenic
939440152 2:142237582-142237604 CAAGTTATGATGGGTTTGTAAGG + Intergenic
941502558 2:166298011-166298033 CAACTTATGACAATTGTGTATGG + Intronic
945149408 2:206772900-206772922 CAATTTATGGTGAGTTTGTTGGG + Intronic
946546746 2:220752399-220752421 AAACTTACTCTGAGTGTGAATGG + Intergenic
947068355 2:226256360-226256382 CAACAAATGCTCAGTGAGTATGG + Intergenic
948232561 2:236361926-236361948 TTTCTTATGCTGAGTGTATACGG - Intronic
1170973321 20:21137320-21137342 CAAATTATGCCAAGTGTGGAGGG + Intronic
1171079322 20:22162208-22162230 TAACTTAGGATAAGTGTGTAGGG + Intergenic
1173209485 20:41021088-41021110 GAACTTAAGCAGTGTGTGTATGG - Intergenic
1178288126 21:31343242-31343264 TAGCTTTTGCTCAGTGTGTAGGG - Intronic
1183137971 22:35908300-35908322 CAACTTATGATGAGTTTATAGGG - Intronic
949877704 3:8637212-8637234 CAACTTATGATGGGTGTATTGGG + Intronic
950078546 3:10205108-10205130 CAACTTCTGATTAGTTTGTATGG + Intronic
952147349 3:30547980-30548002 AAATTTATGCTGAGTGGGTTGGG - Intergenic
954704289 3:52470925-52470947 CAACTTATGCTCAGTATTTCAGG - Intronic
955506660 3:59639520-59639542 CAGCTTATCCAGAGTGGGTATGG - Intergenic
959793394 3:110392491-110392513 CATCTTAAGCTGAGTCTCTAGGG - Intergenic
967883335 3:194316805-194316827 CAACATAGCCTGATTGTGTAAGG - Intergenic
974356848 4:60823934-60823956 CCATTTTTGCTGCGTGTGTAAGG + Intergenic
979342672 4:119545385-119545407 TAAATTATTCTGAGTTTGTATGG - Intronic
979603212 4:122608706-122608728 CAACTGACACTGAGTATGTATGG + Intergenic
986236755 5:5917814-5917836 CAACTTAAGCTGAGTCTGAGGGG + Intergenic
989306167 5:39959342-39959364 CAACATATTTTGATTGTGTAAGG + Intergenic
991022472 5:61994081-61994103 CTACTTATGCTGAGTTTTTGAGG - Intergenic
994209036 5:97067651-97067673 CAACGTATGCTGAGCTTTTAAGG + Intergenic
996190474 5:120534643-120534665 CAACTTATGCTGAGTGTGTAAGG - Intronic
997879452 5:137576339-137576361 GTTCCTATGCTGAGTGTGTAGGG - Intronic
1003695132 6:8398110-8398132 CAACTTATGATGGGTTTATAAGG - Intergenic
1005369457 6:25115715-25115737 CAACTTATGATGAGTTTATCAGG + Intergenic
1007694407 6:43723192-43723214 CCACTTTTACTGAGAGTGTAGGG + Intergenic
1008022942 6:46601185-46601207 CAAATTTTGCTGATTGTTTAAGG - Intronic
1008683215 6:53896408-53896430 CAACTTGTCCAGTGTGTGTATGG + Intronic
1009654284 6:66520175-66520197 CAGCTCATGATGAGTGTGAATGG + Intergenic
1011045265 6:83074908-83074930 CAACTTAGGATGAGTTTGTGTGG + Intronic
1011055401 6:83198565-83198587 CAAAATAAGCTGTGTGTGTAGGG - Exonic
1014168961 6:118256772-118256794 CAACTTATGATGGGTTTATAGGG - Intronic
1014411901 6:121135095-121135117 TAACTTATGCAGAATGAGTAAGG + Intronic
1015126477 6:129760765-129760787 CAAATTGTTCTGAGAGTGTAGGG + Intergenic
1016701627 6:147060509-147060531 CAATTTCTACTGAATGTGTAAGG - Intergenic
1020849504 7:13333190-13333212 CAACATATGTTGAGTGTATTGGG + Intergenic
1020891099 7:13878709-13878731 CAACATATACTGGGTGTGCATGG + Intergenic
1023364583 7:39451054-39451076 CAATGTAGGCTGAGTGTGTGTGG - Intronic
1024882332 7:54102179-54102201 CAACTGATGATGAGTTTGTTAGG - Intergenic
1026335634 7:69392228-69392250 CAACTTATGATGGGTGTATTGGG - Intergenic
1030120400 7:106104982-106105004 CTGCTTTTCCTGAGTGTGTATGG + Intronic
1033137582 7:138797962-138797984 GAACTTATGCTGGGTGTTTGGGG - Exonic
1037489322 8:19382644-19382666 CAACTTATGCTGGGTTTATCAGG + Intronic
1039356434 8:36821977-36821999 CAACTTATGATGGGTTTATAGGG + Intronic
1041535799 8:58924334-58924356 CTACTTCTGCTTAGTATGTATGG - Intronic
1043062472 8:75522017-75522039 CAACTTATGATGAGTTTATTGGG + Intronic
1043226570 8:77739763-77739785 ATACTTATGCTGAGTATTTATGG + Intergenic
1043325409 8:79044450-79044472 CAACTTATGATGAGTACATAGGG + Intergenic
1047594761 8:126367243-126367265 CAACATATGATGAGTGACTATGG + Intergenic
1052615588 9:30836070-30836092 TAACTTATGCAAAGAGTGTAAGG + Intergenic
1054761604 9:69009937-69009959 CTACTTATGCTGAGTAACTATGG - Intergenic
1055093442 9:72386155-72386177 CAACTTATGATGAGTTTTTCAGG - Intergenic
1055891912 9:81132749-81132771 CAATTTATGCTGAGTAGTTATGG - Intergenic
1058177694 9:101756330-101756352 CAACTTATGATGAGTTTATGAGG - Intergenic
1059001106 9:110349678-110349700 CATCTTATGAGGAGTGTGTGTGG - Intergenic
1059347420 9:113639010-113639032 CAAATGATGCTGAGTATGGATGG - Intergenic
1185947433 X:4392768-4392790 CAACTTATGATGAGTTTGTTGGG - Intergenic
1186855176 X:13619471-13619493 CACCTGATGCTGAGAGTGAATGG + Intronic
1187038964 X:15573177-15573199 CAACTTATGATGAGTTTATTGGG + Intronic
1188681432 X:33012838-33012860 CAACTTATGATGGGTTTATAGGG + Intronic
1192488213 X:71549383-71549405 CAACTTATGATGGGTGTATCGGG + Intronic
1193787618 X:85778793-85778815 GAATTTAAGCTGAGTGAGTAGGG - Intergenic
1199299583 X:146197263-146197285 CAACTTATGCTGGGTTTATTGGG + Intergenic
1201734980 Y:17249583-17249605 CAACTTATGATGGGTTTGTTAGG - Intergenic