ID: 996191900

View in Genome Browser
Species Human (GRCh38)
Location 5:120554812-120554834
Sequence GAAATTATGAGAGGTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996191900 Original CRISPR GAAATTATGAGAGGTGTTTC TGG (reversed) Intronic
900807523 1:4777156-4777178 GCAAATCTGAGAGATGTTTCTGG - Intronic
906333719 1:44909771-44909793 CAAATTAAGAGAGGTATTTTGGG + Intronic
907380070 1:54079841-54079863 CAAATTATGCTATGTGTTTCAGG + Intronic
907548622 1:55285251-55285273 GGAATTATGTGAGGTGTGGCAGG + Intergenic
907995688 1:59629826-59629848 TAAATCCTTAGAGGTGTTTCGGG - Intronic
908010352 1:59769892-59769914 GAAATTATGTGTGTTATTTCCGG + Intergenic
908684882 1:66705384-66705406 GAAAACATAAGAGGTTTTTCTGG + Intronic
909310770 1:74145427-74145449 GAATTTGTTAGAGGTTTTTCAGG - Intronic
911750032 1:101485925-101485947 TAAATTATGAGAGATGCTTAGGG + Intergenic
915770233 1:158414533-158414555 GAAATTGTTAAATGTGTTTCTGG + Intergenic
915905522 1:159874005-159874027 GAAATTTGGAGAGGTGGATCAGG - Intronic
917526486 1:175792699-175792721 GACATGATGAGAGATGTTCCAGG + Intergenic
918382020 1:183965686-183965708 GACATTCTGAGAGGAGTTTGAGG + Intronic
919097145 1:193051231-193051253 GAAGTTAAAAGAGGTGATTCTGG + Intronic
919187773 1:194176209-194176231 CAAATTCTGAGGGCTGTTTCTGG - Intergenic
921601563 1:217111674-217111696 GAAAATTTGGGAGATGTTTCAGG - Intronic
923830702 1:237552489-237552511 GAAAATATTGGAGGTGTTTTCGG - Intronic
1063507401 10:6613351-6613373 GAAATTCTTAGAGGCTTTTCAGG - Intergenic
1064751414 10:18533537-18533559 GAAAATATGAGGTGTGTTTTTGG + Intronic
1065225993 10:23544633-23544655 GAACTTGAGAGAGGTGATTCAGG + Intergenic
1069566632 10:69467806-69467828 GACACTATGAGAGATGTTTTAGG - Intronic
1070996309 10:80786309-80786331 GAAATTATTAGAGGAGATGCTGG + Intergenic
1072368892 10:94744203-94744225 GAACTTGTGAGAGATGTTTTAGG + Intronic
1073079308 10:100848158-100848180 GAAATTAGGAGGGGTGCTACGGG - Intergenic
1073847048 10:107568496-107568518 GAACTTAAGAGAGGTGATTTAGG - Intergenic
1078028540 11:7723769-7723791 GAAAATTTGCGAGGTCTTTCAGG - Intergenic
1078973269 11:16440474-16440496 GAAATGAAGATAGTTGTTTCTGG - Intronic
1079786801 11:24683397-24683419 CAGATTATCAGAGGAGTTTCAGG - Intronic
1080258967 11:30324576-30324598 GACATTATCACAGGGGTTTCGGG - Intronic
1080474709 11:32579223-32579245 GAAATTTTGAGAGCAGCTTCTGG - Intergenic
1083276653 11:61600694-61600716 GCTATTCTGAGAGGTCTTTCAGG - Intergenic
1086192639 11:84097821-84097843 AAAATTAGGAGAGATTTTTCAGG - Intronic
1086221496 11:84450460-84450482 GAAAACATGAGATGTGTTTGAGG + Intronic
1086837351 11:91641274-91641296 GAAAATATGATTGGTGTGTCTGG + Intergenic
1087115634 11:94521535-94521557 CAACTTATGATAGGTTTTTCAGG + Intergenic
1089264432 11:117248691-117248713 GAAATTATGAGGAGTGTACCTGG + Intronic
1089832489 11:121340980-121341002 CAAATTATGAAGGGTTTTTCGGG - Intergenic
1090424394 11:126597046-126597068 GAATTTCTGAGAGGTCTGTCTGG - Intronic
1092688667 12:11081648-11081670 GATATTTTGAGAGGTAGTTCTGG - Intronic
1093773572 12:23046391-23046413 GAAATGATGAAATGTGTATCTGG + Intergenic
1097888439 12:64753775-64753797 GAAATTATCAGAGCTTTTTTTGG - Intronic
1099493818 12:83319733-83319755 AGAATTATGAGAAGTATTTCTGG + Intergenic
1100126583 12:91434240-91434262 TAAATTATGAGATGGGTTTATGG + Intergenic
1101212419 12:102547738-102547760 GAAATTGTGTGTGGAGTTTCAGG + Intergenic
1101665728 12:106811769-106811791 GAAGGTATGAAAGGTGTTTGAGG + Intronic
1104259702 12:127171353-127171375 GAAATGATGGGATGTTTTTCTGG - Intergenic
1104529658 12:129557367-129557389 GAAATGAGGAGACGTGTTTAAGG + Intronic
1106496792 13:30285929-30285951 GAACTTGAGAGAGGTGTTTATGG + Intronic
1107694218 13:42984834-42984856 GAAATTAGGAAATGTTTTTCTGG + Intronic
1107969107 13:45624204-45624226 AAAATTCTGATAGGTCTTTCAGG + Intergenic
1109175461 13:59149913-59149935 GAAAATAGGAGATGTGTTTTAGG - Intergenic
1109887738 13:68564413-68564435 GAAATTAGGAAAGGCTTTTCTGG - Intergenic
1110324788 13:74201526-74201548 GAACTTATAGGAGGTGTCTCAGG - Intergenic
1111129713 13:83958951-83958973 GAAATTGCCAGCGGTGTTTCTGG - Intergenic
1111601697 13:90482316-90482338 GAACTTATGAGAGATGATTTAGG - Intergenic
1117511256 14:56453785-56453807 GAGAATTTGAGAGGTGTGTCAGG + Intergenic
1119868172 14:77991419-77991441 GAAATTTTCCGAGGTGGTTCTGG + Intergenic
1120285915 14:82501384-82501406 GTAATTATGTGAAGTGTTTCTGG - Intergenic
1124356608 15:29000119-29000141 GATAGTCTGTGAGGTGTTTCTGG - Intronic
1125231582 15:37462887-37462909 GAACTTAAGAGAGGTGATTTCGG - Intergenic
1127677594 15:61257623-61257645 GAAATTATGAAGGGATTTTCCGG - Intergenic
1132284387 15:100650695-100650717 AAAATTATGAGAGCTCTTCCTGG + Exonic
1133607403 16:7401404-7401426 AAAATAATGATAGGTGTTTTGGG + Intronic
1137336063 16:47550395-47550417 GAAATTATGAGAACAGTTTCAGG - Intronic
1137934370 16:52620217-52620239 GAAATTAAGAGAAGTACTTCAGG + Intergenic
1139074105 16:63422210-63422232 GAATTTAAGAGAGGTGGATCTGG - Intergenic
1139824924 16:69749581-69749603 GAAATGTGCAGAGGTGTTTCTGG + Exonic
1140665877 16:77226906-77226928 GAAGTTTAGAGATGTGTTTCAGG - Intergenic
1141733386 16:85836831-85836853 GAGAGTTTGAGAGGTGTGTCTGG + Intergenic
1143785649 17:9253642-9253664 GAGAGGATGAGAGGTGTTTTAGG + Intronic
1144197775 17:12911869-12911891 GAAATTAGAAGAGGTTTCTCAGG + Intronic
1144241554 17:13317616-13317638 GAAAATACAAGAGGTGTTTATGG + Intergenic
1149150503 17:53557572-53557594 GAATTGATGACTGGTGTTTCAGG + Intergenic
1149309685 17:55382032-55382054 GAAAATATAAGAGGAGATTCAGG + Intergenic
1150006872 17:61475438-61475460 GAACTGATGGGATGTGTTTCAGG + Intronic
1153715483 18:7843481-7843503 GAATTTCTGATAGGTGTTTTAGG + Intronic
1155174086 18:23287970-23287992 GAAATTATGAGAGCTGTAGAGGG - Intronic
1155290350 18:24334836-24334858 GGAATTATAAAAGGTTTTTCAGG - Intronic
1155290434 18:24335640-24335662 GGAACTATGAAAGGTTTTTCAGG + Intronic
1156140416 18:34101933-34101955 GAAAATAGGAGAGGAGTTTAAGG - Intronic
1156410337 18:36822136-36822158 GAAATTTTGAGAGCTGTGACTGG + Intronic
1156879898 18:42064250-42064272 GAAATGATGATTGGTGTATCTGG + Intronic
1158016902 18:52793724-52793746 GAAAATATGAGAAATGCTTCAGG - Intronic
1159160625 18:64639728-64639750 GAAATGAAGAGATGTGGTTCTGG - Intergenic
1159194570 18:65096089-65096111 GAAATATTGAGAGGTGTATCAGG - Intergenic
1159334763 18:67048089-67048111 GAAAATAGGGGAGATGTTTCAGG - Intergenic
1160314361 18:77827195-77827217 GGAATCATTAGAGCTGTTTCTGG - Intergenic
1161122607 19:2537770-2537792 GAAATTATGAAAGGTCTTGAGGG + Intronic
1162155298 19:8673700-8673722 GAAATTCTCAGAGGAGTTCCTGG + Intergenic
1162337309 19:10069925-10069947 GAAAACATGAGGGGTGTTTCAGG + Intergenic
1164415280 19:28042030-28042052 GAAGTATTGAGAGGTGTTTCAGG - Intergenic
1165217924 19:34290026-34290048 CAACTTATGAGAGGTTTATCAGG - Intronic
1167060746 19:47144344-47144366 AAATTAATGAAAGGTGTTTCAGG + Intronic
927835197 2:26391476-26391498 CAAAGTATGAAAGGTCTTTCAGG + Exonic
928001243 2:27524598-27524620 GAATTTGGGAGAGGTGTTTGTGG - Intergenic
928793497 2:34987858-34987880 GAACTAAAGAGAGGTGTTTATGG + Intergenic
929669665 2:43863918-43863940 CAGATTGTGAGAGATGTTTCCGG - Intronic
929844379 2:45507217-45507239 GAAATTATGAGATGTGTGTCTGG - Intronic
930794338 2:55372002-55372024 GAATTTATGAAAAGTGTTTTAGG - Intronic
933083037 2:78017673-78017695 GAAAATATGAGAAGTTTTTCTGG - Intergenic
936408595 2:112232980-112233002 GAAATTGTGATAAGTCTTTCTGG + Intronic
938138293 2:128776671-128776693 GAATGGATGGGAGGTGTTTCAGG - Intergenic
939330148 2:140747769-140747791 GACATTATGCTAGCTGTTTCAGG - Intronic
939522609 2:143249291-143249313 TAAATTATGAGACTTTTTTCTGG - Intronic
941415624 2:165217492-165217514 GAAGCTATTAGAGGTTTTTCTGG - Intergenic
943338815 2:186652064-186652086 GAAACTTTGAGAGCTGTTCCAGG - Exonic
944225889 2:197348384-197348406 GAAATTATTAGAGGTTTACCTGG + Intergenic
946514609 2:220398064-220398086 GAAATTATCTGAGTTGTTTCAGG + Intergenic
1170801979 20:19598100-19598122 GAAAGTTTGAGGGGTGTTTTTGG + Intronic
1170860553 20:20099102-20099124 GAAATAATTACTGGTGTTTCAGG + Intronic
1172074027 20:32279995-32280017 GAAATGATGAGAGGACTTTTTGG + Intronic
1173216276 20:41087635-41087657 GAAATTAAGGGAAGTTTTTCTGG - Intronic
1173320694 20:41984533-41984555 GAAATTAAGACAGGTCTTTAGGG - Intergenic
1178934207 21:36846954-36846976 AAAATTGTGAGAGCTGTTCCTGG - Intronic
1179166354 21:38938203-38938225 CAGATTAGGAGAGGTGCTTCTGG - Intergenic
1179384527 21:40929638-40929660 GAACTTGAGAGAGATGTTTCAGG - Intergenic
1180106403 21:45621573-45621595 GCAAATATGAGAGTTGTTACAGG + Intergenic
1180575756 22:16772466-16772488 GAAATAAAGAAAGGTGTTTGTGG - Intergenic
1184517600 22:44972263-44972285 GAAAATATGAAAGGTGATTAAGG + Intronic
1184985064 22:48126278-48126300 GTAATTATTTTAGGTGTTTCTGG - Intergenic
951091006 3:18573828-18573850 GATATGATGGGAGGTGTCTCTGG - Intergenic
951779910 3:26350776-26350798 GAAATGCAGAGAGATGTTTCTGG - Intergenic
955396206 3:58559584-58559606 TAAATTATGAGTGTTGGTTCGGG - Intergenic
958731347 3:97963657-97963679 GATGGTATGAGAGGTCTTTCAGG + Intronic
958788479 3:98624507-98624529 GTAAATATGAGAGGTGTTAGTGG - Intergenic
959047064 3:101485664-101485686 CATATTATCAGAGTTGTTTCTGG - Intronic
959754333 3:109879002-109879024 GTATTTATGAGAAATGTTTCAGG + Intergenic
963962518 3:151324828-151324850 CAAATGTTGAGATGTGTTTCTGG + Intronic
966320428 3:178695544-178695566 GAATTTATGAGAGATGATTTAGG - Intronic
967401780 3:189070954-189070976 GAAATTCTCAGATTTGTTTCTGG + Intronic
969107328 4:4817556-4817578 GAAACTATGCCAGGGGTTTCAGG - Intergenic
970914525 4:21317365-21317387 GAAATTATTAAAGGTGTTTTTGG - Intronic
971769653 4:30879984-30880006 GAAACTATGAGTGGGGTTTAGGG - Intronic
972046584 4:34672488-34672510 GAAATTATAATAGGAGTCTCTGG + Intergenic
973599848 4:52531486-52531508 GAAACTAACAGAGGTGTTGCAGG - Intergenic
973670127 4:53208663-53208685 GGAATTATGAGAGGTGTATATGG - Intronic
974695058 4:65356633-65356655 TGAAATATGAGAGGTGTTTTAGG - Intronic
975070505 4:70131966-70131988 GAGATATTGAGAGGTTTTTCAGG - Intergenic
975969989 4:80021898-80021920 GTAATTATGAGTGGTGTTTATGG - Intronic
977359642 4:95985848-95985870 GAAAGTATTATAGTTGTTTCAGG + Intergenic
977403395 4:96563835-96563857 GAAATTTTGAAAGGGGTGTCTGG + Intergenic
978144321 4:105354095-105354117 GAAATTATGAGATCAGTTTCAGG - Intergenic
980751308 4:137092941-137092963 GTAATTATGATAGGTGGTTGGGG + Intergenic
980866654 4:138561058-138561080 GAAATGTGCAGAGGTGTTTCTGG - Intergenic
981588473 4:146329643-146329665 GTAAATCTGAGAGGAGTTTCAGG + Intronic
981824052 4:148918913-148918935 CAAATTATGATAGGTTTATCAGG - Intergenic
983718998 4:170822366-170822388 GAAATCAGGAGACTTGTTTCAGG + Intergenic
983762783 4:171433278-171433300 AATATTATGAGACTTGTTTCTGG - Intergenic
985785989 5:1895035-1895057 GAACTTGAGAGAGGTGTTTTAGG + Intergenic
985859211 5:2457420-2457442 GAGATTTTGAAAGGTGTTTAAGG + Intergenic
986173360 5:5331765-5331787 GAAGTTATTACAGGTGGTTCTGG - Intergenic
986810414 5:11352355-11352377 GAAACTATGAGAGCTATTTAAGG - Intronic
986823674 5:11497359-11497381 GAAATTATGATGGGTGCTGCAGG + Intronic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
988933976 5:36064763-36064785 AAAACAATGAGAGCTGTTTCTGG + Intronic
989589573 5:43100874-43100896 AAAATTATTAGAGAAGTTTCAGG + Intronic
990533251 5:56694810-56694832 GAAGATATCAGAGGTGTTTACGG + Intergenic
990797171 5:59556665-59556687 GTAACTATGAGATGGGTTTCTGG + Intronic
990995307 5:61727048-61727070 GAAATGTTGAGAGGTGTTAAAGG - Intronic
991951860 5:71954332-71954354 GAAAGTAGGAGAGCTGTTCCAGG - Intergenic
994120955 5:96112199-96112221 AATATTCTGAGAGGTGTGTCTGG + Intergenic
994583049 5:101672278-101672300 GAAATAATGAGAAGTAGTTCAGG - Intergenic
995306221 5:110654033-110654055 GTAAATATGAGAGGAGATTCAGG + Intronic
996191900 5:120554812-120554834 GAAATTATGAGAGGTGTTTCTGG - Intronic
996458923 5:123718861-123718883 GAAAATGTGAATGGTGTTTCTGG + Intergenic
996823347 5:127654641-127654663 GAAAGTATGAGAGTTGATCCAGG + Intronic
999117588 5:149177314-149177336 GAGATTATAAGAGCTGCTTCTGG - Intronic
999539862 5:152559603-152559625 GCAAGTGTCAGAGGTGTTTCAGG - Intergenic
1000414266 5:160966898-160966920 GAAATTTTTAGAAGTCTTTCTGG + Intergenic
1004824016 6:19400881-19400903 TAAATTAAGGAAGGTGTTTCTGG - Intergenic
1004885812 6:20050582-20050604 GAAATTATCATGGGTGTTTCAGG + Intergenic
1007198532 6:40085024-40085046 GAATTTAGGAGAGGTGTGGCAGG - Intergenic
1007947140 6:45836866-45836888 GGAAATATGGGAGGTGCTTCAGG + Intergenic
1009405938 6:63312922-63312944 GAAATTATGAGTTCTGTTTTGGG + Intronic
1010430122 6:75769122-75769144 GACCTGATGGGAGGTGTTTCAGG - Intronic
1011582660 6:88887466-88887488 AAAATTTTGCAAGGTGTTTCTGG - Intronic
1011883288 6:92058906-92058928 GAACTTAAGAGAGGTGATTTAGG + Intergenic
1012814401 6:104003761-104003783 GAAATTTTGACAGGTACTTCTGG + Intergenic
1014049319 6:116933844-116933866 GAAAAAATGTGAGGTGTTTTTGG - Intergenic
1014872996 6:126619631-126619653 GAAATTAGAAGAGCTGTTTATGG + Intergenic
1015168867 6:130228916-130228938 TACATTATTACAGGTGTTTCTGG + Intronic
1016746401 6:147585109-147585131 TTACTTATGAGAGGTGTGTCGGG + Intronic
1018287610 6:162257648-162257670 GGAATTAAAAGAGGTATTTCAGG + Intronic
1018379056 6:163240932-163240954 GATGTTATGAGAAGTCTTTCTGG - Intronic
1020804783 7:12775636-12775658 GAAAGTATGATAGGTGAGTCTGG + Intergenic
1022942419 7:35253696-35253718 GAAACTTTGAGCTGTGTTTCGGG - Exonic
1024006416 7:45227770-45227792 ATAAATTTGAGAGGTGTTTCAGG - Intergenic
1024536650 7:50440402-50440424 TCAAATATGACAGGTGTTTCTGG - Intergenic
1024713127 7:52040309-52040331 GATATTATGGTAGGTGATTCTGG - Intergenic
1028367570 7:90051931-90051953 GAAGTTGTGAGAGATGTTCCTGG + Intergenic
1028431859 7:90756819-90756841 AAGATAATGAGAGCTGTTTCTGG - Intronic
1029660792 7:101960032-101960054 GAAATTGAGAGAGCTTTTTCCGG + Intronic
1031524429 7:122807351-122807373 GAACCCATGAGAGGTGTTCCAGG + Intronic
1031819746 7:126485485-126485507 GAAATGATGAGTGGTGTCTGGGG + Intronic
1032648176 7:133848638-133848660 GAAAGTATGAAAGATATTTCAGG - Intronic
1033778324 7:144639173-144639195 AAAATTATGAGAGCATTTTCAGG + Intronic
1036531310 8:9590364-9590386 GAAATTATGACAGCTTTGTCAGG - Intronic
1037073551 8:14683291-14683313 GAAAGTATGACAGATGTTTAAGG + Intronic
1038250000 8:25894528-25894550 GAAATGGAGTGAGGTGTTTCAGG - Intronic
1038602673 8:28962593-28962615 GAAATTATGAGATTTATTTAGGG - Intronic
1039331084 8:36537276-36537298 GAAATTATGAGTATTGTTTGGGG + Intergenic
1040985310 8:53287386-53287408 GATATTATTACAGTTGTTTCTGG + Intergenic
1041715392 8:60927378-60927400 GAAAGTGTGAGGGGTGTTTCTGG + Intergenic
1042647754 8:71006185-71006207 GACATTATGAGAGATATTCCAGG + Intergenic
1046010502 8:108540772-108540794 GAAATTATGAAAGATGTGTCTGG - Intergenic
1050280183 9:4042386-4042408 GATATTCTGAGAGCTGCTTCCGG + Intronic
1052282976 9:26754082-26754104 GAAACTCTTAGAGGTCTTTCTGG - Intergenic
1052576126 9:30293699-30293721 GAACTTGAGAGAGGTGATTCAGG - Intergenic
1058948150 9:109878035-109878057 GAAATTTTGAGAGGTTTTTGTGG + Intronic
1059867414 9:118531288-118531310 TAAATTATGAGAGGTTTTCAAGG + Intergenic
1060274309 9:122170794-122170816 AAAATTTTGAGACGTGTTCCAGG + Intronic
1186263485 X:7806496-7806518 GAAATTATGAAAGGTGCCCCAGG + Intergenic
1187620547 X:21048467-21048489 GAAATTGTGAGAAATGTTTATGG - Intergenic
1188753898 X:33936628-33936650 GAACTTAAGAGAGGTGATTTAGG - Intergenic
1189070737 X:37861117-37861139 TAAAATATGAGAGGGGTTTCTGG - Intronic
1194453783 X:94077578-94077600 GAACTTATGAGAGATGATTTCGG + Intergenic
1196046565 X:111261925-111261947 GAAATTAAGAGAGGTGTATTGGG - Intronic
1197278563 X:124508685-124508707 GATATTATGAGATTTTTTTCTGG + Intronic
1198138037 X:133774072-133774094 GAAAATATGAAATGAGTTTCTGG + Intronic
1201056053 Y:9993544-9993566 ACAAATATGAGAGGTTTTTCTGG - Intergenic