ID: 996195392

View in Genome Browser
Species Human (GRCh38)
Location 5:120600140-120600162
Sequence AATTAAACAAAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1227
Summary {0: 1, 1: 0, 2: 3, 3: 113, 4: 1110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996195392_996195395 27 Left 996195392 5:120600140-120600162 CCCAGCTCCATTTTTGTTTAATT 0: 1
1: 0
2: 3
3: 113
4: 1110
Right 996195395 5:120600190-120600212 ATATTATCTACTATGTTTGTAGG 0: 1
1: 0
2: 3
3: 29
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996195392 Original CRISPR AATTAAACAAAAATGGAGCT GGG (reversed) Intronic
900169214 1:1258198-1258220 AATTAAAAAAAAAATTAGCTGGG - Intronic
901293474 1:8142588-8142610 AATTAAAAAAAAAAATAGCTGGG + Intergenic
901345051 1:8532753-8532775 AATAATACAAAAATTTAGCTAGG - Intronic
901596243 1:10387445-10387467 AAAAAAAAAAAAAAGGAGCTGGG + Intergenic
901732184 1:11288073-11288095 TGTGAAACAAAAATGGTGCTGGG - Exonic
901812162 1:11773907-11773929 AATTAAAAAAAAATAGAGACAGG + Intronic
901868613 1:12124163-12124185 AATTAAAAAAAAATTTAGCCAGG - Intronic
902421729 1:16286042-16286064 AATTAAAAAAAAAATTAGCTGGG - Intronic
902605603 1:17567525-17567547 AAAAATACAAAAAAGGAGCTGGG - Intronic
902617819 1:17633502-17633524 AATTAAAAAAAAAATTAGCTAGG - Intronic
902853574 1:19181761-19181783 AGTAAAACAAAAATAGTGCTTGG - Intronic
903114105 1:21164067-21164089 AAAGAAACAAAATTGGAGCTGGG - Intronic
903144010 1:21358312-21358334 AATTTCACATAAATGGAGCCAGG + Intergenic
903387812 1:22940233-22940255 AATTAAAAAAAAATTTAGCTGGG - Intergenic
903689046 1:25157247-25157269 AATCAAACAAAAATTGTGCAAGG + Intergenic
903804035 1:25991438-25991460 AATTAAACAAAAAATTAGCTGGG - Intronic
904073756 1:27824055-27824077 ATTAAAAAAAAAATGGAGATGGG - Exonic
905815997 1:40951432-40951454 AATTAAAAAAAAAATTAGCTGGG - Intergenic
906138115 1:43514780-43514802 AATTTAACCAAGATGCAGCTGGG + Intergenic
906235953 1:44209938-44209960 AATAAAACAAAAATCAGGCTAGG - Intergenic
906586185 1:46980890-46980912 ATTTAAAAATAAATGGTGCTGGG + Intergenic
907153603 1:52311558-52311580 AATTAAACATCAATCCAGCTGGG - Intronic
907155752 1:52331937-52331959 AAATAAAAAAAAATTTAGCTGGG - Intronic
907218175 1:52884189-52884211 AATTAAAAAAAAAATTAGCTGGG + Intronic
907460097 1:54600521-54600543 AAATAAACAAAAAATGAGCCAGG + Intronic
907460621 1:54603358-54603380 AAATAAATAAAAATGAAGCCAGG + Intronic
908313830 1:62913061-62913083 ATAGAAACAAAAATGGGGCTGGG + Intergenic
909015744 1:70377745-70377767 AATACAAAAAAAATGTAGCTGGG - Intronic
909043415 1:70681293-70681315 AATTAAAAAAAAATAGATTTAGG + Intergenic
909445660 1:75745327-75745349 AAATAAACAAAAAATTAGCTAGG + Intronic
909762506 1:79309413-79309435 AATGAAACAAAAAAGGAACTAGG + Intergenic
909824259 1:80106878-80106900 TATTAAACTGATATGGAGCTAGG - Intergenic
909958863 1:81811658-81811680 AATTAAAAAAAAACTGATCTGGG - Intronic
910239362 1:85069748-85069770 CATCAAACTAAAATGCAGCTGGG + Intronic
911312641 1:96314315-96314337 TATTAACCAAAAACTGAGCTAGG - Intergenic
911772752 1:101767871-101767893 AATTAAAAAAAAATAGACCTAGG - Intergenic
911808869 1:102247431-102247453 AATTAAAAAAAAAAATAGCTAGG - Intergenic
912102639 1:106231122-106231144 AAAGAAACAAAAATAGAGATTGG + Intergenic
912335804 1:108861491-108861513 AATTAAAAAAAAAATTAGCTAGG - Intronic
912352300 1:109025756-109025778 AAATAAAAAAAAGTGGCGCTAGG + Intronic
912432633 1:109637204-109637226 ACTTGAACAACTATGGAGCTAGG + Intergenic
912701429 1:111881215-111881237 GATTAAAAAAAGATGGAGGTGGG - Intronic
912867799 1:113274187-113274209 AATTACAAAAAAAGGTAGCTGGG - Intergenic
912963187 1:114214046-114214068 ACTTAAAGAATAATTGAGCTAGG - Intergenic
912986036 1:114432038-114432060 CATTAAAAAATAATGGAGATAGG + Intronic
913153580 1:116070842-116070864 AATCAGATACAAATGGAGCTTGG + Intergenic
914230741 1:145763400-145763422 AATAAAATAAAAATGGGGCTGGG + Intronic
914736099 1:150418504-150418526 AATTAAATCAACATGGAGTTGGG - Intronic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
915098529 1:153481837-153481859 AATTAAAAAAATATGGAGGCTGG - Intergenic
915187224 1:154116431-154116453 AAAAAAAAAAAAATGGGGCTGGG + Intronic
915435528 1:155902865-155902887 AATTAAAAAAAAAGAAAGCTGGG + Intronic
915967855 1:160327560-160327582 AATTAAAAAAAAAGGAGGCTGGG + Intronic
916416727 1:164599360-164599382 AAAGAAACAAAAATGGAGGGGGG - Intronic
916874540 1:168954926-168954948 TATTTAATAAAAATGGTGCTGGG - Intergenic
917119647 1:171634304-171634326 TATTAAAAAATAATGCAGCTAGG + Intergenic
917653197 1:177099392-177099414 AAATTAAAAAAAAAGGAGCTAGG - Intronic
917756557 1:178105831-178105853 AAGTAAACAAAAAACTAGCTGGG - Intronic
918063142 1:181079310-181079332 TATTAAAAAAAAATGTAGCTGGG - Intergenic
918364280 1:183790079-183790101 AATTAAAAAAAAAATTAGCTGGG - Intronic
918610595 1:186485833-186485855 AATTAAAAAAAAATCCAGCTAGG - Intergenic
918624733 1:186644448-186644470 AAAAAAATAAAAATGTAGCTAGG + Intergenic
918760155 1:188394040-188394062 AATTAAAAATAAATGAACCTGGG - Intergenic
918948705 1:191106503-191106525 AATTAACCAAAAATGGATGAAGG - Intergenic
918985885 1:191624683-191624705 AATTAAAAAAAAAAAAAGCTGGG + Intergenic
919020391 1:192097967-192097989 ATTTAAGCAAAAATGGAGTTTGG + Intergenic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
919212092 1:194500158-194500180 AAATAAAAAAAAATTTAGCTTGG - Intergenic
919651974 1:200159041-200159063 AATTAAAAAAAAAAATAGCTGGG - Intronic
919658897 1:200223916-200223938 AATTGAACAATAGGGGAGCTTGG + Intergenic
919933865 1:202238716-202238738 AAAAAAAAAAAAATAGAGCTGGG - Intronic
920612821 1:207458268-207458290 AAAAAAAAAAAAATGAAGCTTGG - Intronic
920721531 1:208391894-208391916 GATTGAACAAAAAGAGAGCTAGG - Intergenic
920759487 1:208768747-208768769 AATTATACAAAAAATTAGCTGGG - Intergenic
920951129 1:210572734-210572756 ATATAAAAAAAAATGTAGCTGGG + Intronic
921029462 1:211325115-211325137 AAAAAAAAAAAAAAGGAGCTGGG + Intergenic
921290293 1:213650721-213650743 AACTAAACAAAAATGGAATGGGG - Intergenic
921563925 1:216693301-216693323 AATTAAAGAAAAATAGGGATGGG + Intronic
921686183 1:218091567-218091589 ACTTTAACAATAATGGAACTGGG + Intergenic
921941900 1:220850027-220850049 AATAAAAAAAAAAAGTAGCTGGG - Intergenic
922312805 1:224411864-224411886 AAGTAAAAAAAAATGTAGCTGGG - Intronic
922365075 1:224855902-224855924 AATTAAGCAAAAATGATCCTGGG + Intergenic
922608166 1:226904090-226904112 AACAAAATAAAATTGGAGCTGGG - Intronic
922689164 1:227673430-227673452 AATAAAACAAAATTGGAGGGAGG + Intronic
923163021 1:231334165-231334187 AATGAAACAAAAATGCAGCATGG + Exonic
923166055 1:231363197-231363219 AATTACACTAAAATATAGCTGGG - Intergenic
923227492 1:231951908-231951930 AATTAAAAAAAAAATTAGCTGGG + Intronic
923446361 1:234075212-234075234 AATGAACCAAAAACGGACCTTGG + Intronic
923590355 1:235312676-235312698 AAAAAAACAGAAATGGGGCTGGG + Intronic
923599971 1:235394233-235394255 AAATATACAAAAAAGTAGCTGGG - Intronic
923944610 1:238870242-238870264 CATGAAACAAAAATGGACATTGG - Intergenic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
924304794 1:242676534-242676556 AATGAAAAAAAAATGGAGCAGGG + Intergenic
924514300 1:244753338-244753360 AAAAAAAAAAAAATGGAGATAGG - Intergenic
924666788 1:246081694-246081716 AATTAAAAAAAATAGAAGCTAGG - Intronic
1063032034 10:2245059-2245081 ATTTAAACACAAGTGGGGCTGGG - Intergenic
1063208172 10:3854636-3854658 AAAAAAAAAAAAATGTAGCTGGG - Intergenic
1063435151 10:6023494-6023516 AATCATACAAAAATTAAGCTGGG - Intronic
1063582681 10:7323156-7323178 TATAAAACATAAATGGAGCTGGG + Intronic
1063685237 10:8230845-8230867 AATTAAAAAAAAATAGAGATAGG + Intergenic
1063707966 10:8449315-8449337 AATTAAAAAAAAAATGAGCTGGG + Intergenic
1063789853 10:9430874-9430896 AATTAAACAAAAATTGGTTTTGG - Intergenic
1063860121 10:10297813-10297835 GAGTAAACAAAAATGGAGTGTGG - Intergenic
1063947041 10:11187832-11187854 AATTAAACAAAATTGTAACAAGG - Intronic
1064177471 10:13087408-13087430 AAAAAAAAAAAAATGGTGCTAGG + Intronic
1064344999 10:14524025-14524047 AAAAAAAAAAAAATAGAGCTGGG - Intronic
1064878160 10:20018977-20018999 AAATAAAAAGAAATGGAACTTGG + Intronic
1065353668 10:24818249-24818271 AATTAAAAAAAAAATTAGCTGGG - Intergenic
1065745260 10:28834913-28834935 AATAAAATAAAAAAGTAGCTAGG - Intergenic
1065777781 10:29137905-29137927 AATTAATGAATAAGGGAGCTGGG - Intergenic
1065818320 10:29501785-29501807 AATCAAACCAAGATGGCGCTTGG + Intronic
1066031636 10:31432583-31432605 AATTAAAAAAAAATTGAGACAGG - Intronic
1066472863 10:35716368-35716390 AAGAAAAAAAAAATGAAGCTTGG - Intergenic
1066572527 10:36789173-36789195 AATTAAAGAAAAATTGGGCCGGG + Intergenic
1067256979 10:44650937-44650959 AATAAAACAAAACTGGAGGAGGG + Intergenic
1067393629 10:45889892-45889914 AATTAACTAAAATTGGAGCATGG + Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1067550291 10:47229577-47229599 AAATAAGCAGAAATGGAGCCAGG + Intergenic
1067861954 10:49859047-49859069 AATTAACTAAAATTGGAGCATGG + Intronic
1067880911 10:50044061-50044083 AATTAAAAAAAAAATTAGCTGGG + Intergenic
1067991197 10:51214635-51214657 AAATAAAAAAAAATATAGCTGGG - Intronic
1068213208 10:53949575-53949597 AATTAAAAAAAAAATTAGCTGGG + Intronic
1068428646 10:56902845-56902867 CATTGAACAATAATGGAGATAGG - Intergenic
1068433828 10:56965866-56965888 ACAAAAACAAAAATTGAGCTGGG + Intergenic
1068692949 10:59936554-59936576 AATTAAAAAAAAAATAAGCTGGG - Intergenic
1068846240 10:61678121-61678143 AATTCTTCAAAAATGGTGCTGGG - Intronic
1070023260 10:72607343-72607365 AAAAAAAAAAAAAGGGAGCTGGG + Intronic
1070518731 10:77232877-77232899 AAAAAAAAAAAAATGGTGCTGGG - Intronic
1070691263 10:78528248-78528270 AATTAAATAAAAAAGTAGCCGGG - Intergenic
1070942664 10:80360192-80360214 AATTAAAAAAAAATTGAGTGGGG - Intronic
1071534170 10:86414015-86414037 AAAAAAAAAAAAAAGGAGCTGGG + Intergenic
1071914068 10:90270905-90270927 AAGTAAACACAAAAGCAGCTTGG - Intergenic
1071943529 10:90614835-90614857 AATCAAACAAAAACACAGCTTGG + Intergenic
1072020343 10:91392865-91392887 AATAAAAAAAAAATGCAGGTTGG + Intergenic
1072066582 10:91877365-91877387 ATTTAAAGAAAAATAGAGCTAGG - Intergenic
1072157760 10:92739281-92739303 AAATAAACAAAAAATTAGCTGGG + Intergenic
1072419695 10:95279776-95279798 AATTAAATAAGAATGTTGCTTGG - Intronic
1072592561 10:96840624-96840646 GATTAAAGAAAAATAGAGATGGG + Intronic
1073093206 10:100962333-100962355 AATTAAACCCAACTGGAACTTGG - Intronic
1073097947 10:100991547-100991569 GATGGAACAAACATGGAGCTGGG + Intronic
1073415372 10:103376747-103376769 AAGTAAACAAAAATTGAGCCGGG + Intronic
1074530992 10:114298675-114298697 AATTAAAAAAATATTGAGATGGG - Intronic
1075432493 10:122399922-122399944 TTTTAAGCAAAAATGGGGCTGGG - Intronic
1076069343 10:127474180-127474202 CATTAAACATTAAAGGAGCTAGG + Intergenic
1076130350 10:128009747-128009769 ATTTAAACAATGAAGGAGCTGGG - Intronic
1077208470 11:1355593-1355615 AATAAAATAAAAAATGAGCTGGG - Intergenic
1077580148 11:3412258-3412280 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1077626455 11:3776280-3776302 AATTAAAAAAAAAATTAGCTGGG - Intronic
1078252938 11:9632257-9632279 AATAAAAAAAAAATAGAGATGGG + Intergenic
1078724260 11:13914889-13914911 AATTAAAAAAAAATAGAAGTTGG - Intergenic
1078764384 11:14280280-14280302 CATTAAAAAAAAATGGGACTGGG + Intronic
1078791143 11:14543200-14543222 AATTAACTCAAAATGGAGCCAGG + Intronic
1079519038 11:21302898-21302920 AATTAAAAAAAAAAATAGCTTGG + Intronic
1080799505 11:35597266-35597288 AATTAAACAACAATAGATGTTGG + Intergenic
1080831743 11:35900450-35900472 AAAAATAGAAAAATGGAGCTGGG + Intergenic
1081234571 11:40631686-40631708 AATTAAAAAAAAATGTTGCTTGG + Intronic
1081278149 11:41176651-41176673 AATAAATGAAGAATGGAGCTAGG + Intronic
1081309845 11:41556454-41556476 AATCACACAGAAATGGAGATGGG + Intergenic
1081374883 11:42345845-42345867 AATTAAAAAAAAATTTAGCCAGG - Intergenic
1081459389 11:43257808-43257830 AAAAAGACAAAAACGGAGCTGGG + Intergenic
1081952971 11:47061749-47061771 AAATAAACAAAACGGGAGCTAGG - Intronic
1082046727 11:47735782-47735804 CATTAAAAAAAAATGGGGCCCGG + Intronic
1082211289 11:49505521-49505543 AATTAAAAAAAAAAAAAGCTGGG + Intergenic
1082859792 11:57844391-57844413 AAATAAAAAAAAATTTAGCTGGG + Intergenic
1082863224 11:57874618-57874640 ATTTAAAAAAAAATGCTGCTGGG + Intergenic
1083465906 11:62845930-62845952 AATTAAATAAAAATGAGGCTGGG - Intergenic
1084237072 11:67795085-67795107 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1084253187 11:67918625-67918647 AAATAAACAAAAATAGGGCCAGG - Intergenic
1084472939 11:69373800-69373822 AAATATACAAAAAAGTAGCTGGG + Intergenic
1084819694 11:71677301-71677323 AAATAAACAAAAATAGGGCGGGG + Intergenic
1084826491 11:71735674-71735696 AATTAAACAAAATTAAGGCTGGG + Intergenic
1084835331 11:71797749-71797771 TTTTAAACAAAAATGGGGCTGGG - Intronic
1085397582 11:76214590-76214612 AACAAAACAAAAATGGTTCTGGG - Intergenic
1085540436 11:77262864-77262886 AAAAAAAAAAAAAAGGAGCTGGG + Intronic
1086153525 11:83639758-83639780 AATTAAAAAAAAAAGGTACTGGG + Intronic
1086329146 11:85735889-85735911 AATTAAAAAACAGTGGAGCTGGG - Intronic
1086543106 11:87936330-87936352 AAATAAATAAAAATAAAGCTTGG - Intergenic
1086803918 11:91215592-91215614 AATTAACCTAAAATGGATCATGG + Intergenic
1086924454 11:92625185-92625207 AATTTAACAAAAATGTGGCATGG - Intronic
1087206080 11:95395473-95395495 AATTAAAAAAAAATCCAACTAGG + Intergenic
1087741519 11:101892772-101892794 AATGAAACAAACATAGAGCTTGG - Intronic
1088649093 11:111941653-111941675 AGTTAAAAAAAAAATGAGCTGGG + Intronic
1088665748 11:112091905-112091927 AATAATACAAAAATTAAGCTGGG + Intronic
1088739725 11:112757339-112757361 CATGAAGCTAAAATGGAGCTTGG - Intergenic
1088922425 11:114270767-114270789 AACTAAACAAAAAGGTAACTAGG - Intronic
1089024578 11:115256009-115256031 AAGTAAGCAAAAATTCAGCTAGG - Intronic
1089423967 11:118354461-118354483 AAATACACAAAAAATGAGCTGGG - Exonic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1090352728 11:126117791-126117813 AATTGCAAAAATATGGAGCTGGG + Intergenic
1091182095 11:133614579-133614601 TAATAAATAAAAATGGAGCTGGG + Intergenic
1091736306 12:2924880-2924902 AATTAAAAAAAAATAGGGCTGGG + Intronic
1092269980 12:7016257-7016279 AATTAATAAAAAAATGAGCTGGG - Intronic
1092320000 12:7462086-7462108 AAAAAAAAAAAAATGGTGCTGGG - Intronic
1092549917 12:9487166-9487188 AAGTAAAACACAATGGAGCTGGG + Intergenic
1092954871 12:13540741-13540763 AAATAAACAAAAAAAGAACTTGG + Exonic
1092993703 12:13927804-13927826 AATTAAAAAAAAAATTAGCTGGG + Intronic
1093025498 12:14241630-14241652 AATTAAAAAAAAACAGAGATAGG - Intergenic
1093353747 12:18136789-18136811 AATTAAGATAAAATGGAGGTTGG - Intronic
1093480422 12:19598701-19598723 ATTTAAAAAAAAATAGAGATGGG + Intronic
1093481093 12:19604550-19604572 AATTAAAAAAAAAATTAGCTGGG + Intronic
1093649067 12:21622482-21622504 AAAAAAAAAAAAATGGTGCTGGG - Intergenic
1093807497 12:23452345-23452367 AATGAAACAGGAAGGGAGCTAGG - Intergenic
1094071984 12:26426460-26426482 AAGTAGAGAAACATGGAGCTGGG + Intronic
1094404753 12:30105559-30105581 AACTACACAACAATGGAACTAGG + Intergenic
1094425979 12:30317559-30317581 AGTTAAACACAAATTGAGCCAGG + Intergenic
1094426185 12:30319732-30319754 AGTTAAACACAAATTGAGCCAGG + Intergenic
1094583190 12:31753350-31753372 AATTAAAAAAAAATTTAGCCAGG + Intergenic
1094646028 12:32325132-32325154 AAAAAAACATAAATGGAGCCAGG - Intronic
1095194222 12:39294407-39294429 AATTAAACATGAATGAAGATAGG - Exonic
1095211257 12:39497925-39497947 AATGAAACAAAAAAGCAGATGGG + Intergenic
1095538830 12:43284657-43284679 AATGAAACAGAACTGGATCTTGG - Intergenic
1095891739 12:47241329-47241351 AAATAAACAAAAAAATAGCTGGG - Intergenic
1096061290 12:48702822-48702844 AAGAAAAAAAAAATGTAGCTAGG + Intronic
1096379938 12:51148123-51148145 AATTAAAAAAAAATAGATGTTGG + Intronic
1096381724 12:51164040-51164062 AATTAAAAAAAAAATTAGCTGGG + Intronic
1096637880 12:52972822-52972844 AAATAAAAAAAAATTTAGCTGGG - Intergenic
1096987256 12:55768284-55768306 AATTAAAAAAAAAATTAGCTGGG - Intronic
1097006410 12:55922032-55922054 ATTTAAAAAAAAAACGAGCTGGG - Intronic
1097213948 12:57395209-57395231 AATTAAAAAAAATTAGAGCCGGG + Intronic
1097217651 12:57426995-57427017 AATAAAACAAAAATGTGGCTGGG + Intronic
1098403048 12:70094038-70094060 AAGGAAACAAACATTGAGCTGGG + Intergenic
1098615979 12:72522945-72522967 AAGTAAACAAAAGTGGAATTAGG - Intronic
1099232677 12:80045255-80045277 AATTCAGCAAAAAAGGAGTTTGG - Intergenic
1099817332 12:87666985-87667007 TATTAAACAACAAGGGAGCCAGG - Intergenic
1099909634 12:88813801-88813823 AATTAAGCAAATAGGGAGGTTGG - Intergenic
1099984395 12:89646364-89646386 AAGTAGACAAGAAGGGAGCTAGG + Intronic
1100126299 12:91430556-91430578 AAATAAAATAAAATGGAGCTTGG - Intergenic
1100132628 12:91515223-91515245 AATTAAATAAAAATGGTCCTAGG + Intergenic
1100132648 12:91515512-91515534 AATTAAATAAAAATGGTCCTAGG - Intergenic
1100193649 12:92219725-92219747 ATTTTTACAAAACTGGAGCTGGG - Intergenic
1100229784 12:92595192-92595214 AATTAAAAAAAAAAGTGGCTGGG - Intergenic
1100233925 12:92638206-92638228 AAATATACAAAAATATAGCTAGG + Intergenic
1100417024 12:94388829-94388851 AATTGAAAAAAAATGTGGCTGGG + Intronic
1100929298 12:99587054-99587076 AATTAGACAAAGTGGGAGCTAGG + Intronic
1100935115 12:99655544-99655566 AATTAAGGAAAAATGCAGTTAGG + Intronic
1101483619 12:105128936-105128958 AAAAAAAAAAAAATGTAGCTGGG - Intronic
1101644897 12:106622613-106622635 AAAAAAAAAAAAATGCAGCTTGG - Intronic
1101826122 12:108221393-108221415 AAAAATACAAAAATTGAGCTGGG + Intronic
1102359521 12:112272343-112272365 AATTAAAAATAAATGAGGCTAGG - Intronic
1102393195 12:112566326-112566348 AATTAAAAAGAAATTCAGCTGGG + Intergenic
1102647598 12:114413992-114414014 AAAAAAAAAAAAATGGAGCCGGG - Intergenic
1102851071 12:116245738-116245760 AAATAAACAAAAATGGAAAATGG + Intronic
1103085161 12:118057173-118057195 AAACAAACAAAAACAGAGCTGGG + Intronic
1103567870 12:121826080-121826102 AATTAAAAAAAAATTGAGACGGG + Intronic
1103804389 12:123561002-123561024 AATTAAAAAACAATGCAGCCAGG - Intergenic
1104284102 12:127407418-127407440 AAAAAAAAAAAAATAGAGCTGGG + Intergenic
1104494307 12:129222385-129222407 AAGGAAACAAAAATGGAGTTAGG - Intronic
1105241904 13:18615536-18615558 AATTACAAAAAACTGGAGCTAGG - Intergenic
1105774763 13:23647560-23647582 TATTAAAAAAAAATGTAGCTGGG - Intronic
1105968766 13:25408097-25408119 CATTAAAAAAAAATGTGGCTGGG + Intronic
1106172483 13:27299982-27300004 AATTAAAAAAAAAATTAGCTGGG + Intergenic
1106216887 13:27709933-27709955 CATTAAGCAAACAAGGAGCTGGG - Intergenic
1106316008 13:28594324-28594346 AATTAAACAAAAATAAAACAAGG + Intergenic
1106504460 13:30359115-30359137 AAATAAATAAAAAGGAAGCTAGG - Intergenic
1106638207 13:31553796-31553818 AATATAACAAATATGGAGGTGGG - Intergenic
1106837394 13:33649720-33649742 AATTTAAAAAAAATTGACCTTGG + Intergenic
1106920189 13:34554958-34554980 AATCAAACAAAATTGGAGGTAGG + Intergenic
1107215227 13:37909487-37909509 AATTAAAAAAAAATGAAGTCAGG + Intergenic
1107567209 13:41617412-41617434 ATTTAAAAAAAAATGTATCTTGG - Intronic
1107685907 13:42897840-42897862 TATTAAACAAAAATAGAAATTGG - Intronic
1108022383 13:46141110-46141132 TAAGAAACAACAATGGAGCTGGG + Intronic
1108150734 13:47531283-47531305 AATAAAAGAAAAAAGCAGCTTGG + Intergenic
1108185659 13:47886050-47886072 CTTTAAAAAAAAATGGAGTTAGG + Intergenic
1108367636 13:49731763-49731785 CACTAAACAAAAATGGAAATAGG + Intronic
1108729170 13:53215328-53215350 AATTATATATACATGGAGCTAGG - Intergenic
1108758999 13:53539968-53539990 AATTAACTAAAACTGGGGCTGGG + Intergenic
1108843694 13:54652388-54652410 CATTAAAAAAAAATGGTACTAGG - Intergenic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1109310559 13:60687690-60687712 AATTATACAAAATTATAGCTAGG - Intergenic
1109440838 13:62370828-62370850 AATTAAAAAAAAAAAAAGCTAGG - Intergenic
1109473545 13:62845161-62845183 AATGAAATAAAAATGGAAATGGG + Intergenic
1109525890 13:63575419-63575441 AATTAAAAAAAAATACAGCCTGG + Intergenic
1109670138 13:65594417-65594439 ATTAAGACAAAAATGCAGCTGGG + Intergenic
1109822355 13:67674486-67674508 AACTCAACAAATATTGAGCTAGG + Intergenic
1109862212 13:68215007-68215029 AATTAAACGAAAATGAAATTTGG + Intergenic
1109873810 13:68371337-68371359 AATTAAAAAAAAAATTAGCTGGG - Intergenic
1110045787 13:70828909-70828931 AAGAAAAAAAAAATGGGGCTGGG + Intergenic
1110087040 13:71393576-71393598 AAATAAACCAAAATGGAGACAGG + Intergenic
1110179731 13:72601463-72601485 AAATAAACAAAAATGGACTTTGG - Intergenic
1110491080 13:76108758-76108780 AATGAAAAAAAAATGAAACTAGG + Intergenic
1110755872 13:79172956-79172978 AATTAAAAAAAAATAGATGTTGG - Intergenic
1111422160 13:88026452-88026474 AATTAAACAAAAATCATTCTTGG - Intergenic
1111510227 13:89251446-89251468 AATTAAATGAAAATAGAGCACGG - Intergenic
1111547081 13:89753075-89753097 AATTAAAATATAATGGGGCTTGG - Intergenic
1111680215 13:91433193-91433215 AATTAAAAAAAAAAAGAGCCTGG - Intronic
1112397623 13:99047677-99047699 AATTAAAAAAAAAATTAGCTGGG - Intronic
1112522659 13:100111170-100111192 AAAAAAAAAAAAAAGGAGCTGGG - Intronic
1112974055 13:105294996-105295018 AATTAAACAAAAATGACAATGGG + Intergenic
1113062177 13:106334288-106334310 AATTATTCAAAAAAGGAGATGGG - Intergenic
1113498931 13:110757918-110757940 AATTTAACAAAAAATTAGCTGGG - Intergenic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1114502115 14:23178023-23178045 AACTAAAAAATATTGGAGCTAGG - Intronic
1114525224 14:23363937-23363959 AAAAAAAAAAAAATGGAGTTTGG + Intronic
1114955894 14:27818782-27818804 AATTAAAAAAAAAAAAAGCTAGG + Intergenic
1114961511 14:27896482-27896504 AATTAAAAAATAATGGATGTTGG - Intergenic
1115120680 14:29933029-29933051 AAATGAACAAAAATAGAGATAGG + Intronic
1115365228 14:32550184-32550206 AGTTCTACAAAAATGCAGCTAGG + Intronic
1115503678 14:34073197-34073219 AAACCAACAAAAATGGAGGTAGG + Intronic
1115587067 14:34825012-34825034 AATCACACAAACATGTAGCTAGG - Intronic
1115760015 14:36570828-36570850 AATAAAAACAAAATGGAGCAAGG + Intergenic
1115870987 14:37802398-37802420 AATAAAAAAAAAATGAAACTGGG + Intronic
1116096088 14:40370557-40370579 AATCAAACAAAAATATTGCTTGG + Intergenic
1116812859 14:49556056-49556078 ATTTAAAAAAAAATGGGGCTGGG - Intergenic
1116896089 14:50316061-50316083 AATTAAAAAAAAATAGATGTTGG - Intronic
1116900092 14:50353733-50353755 ATTTAAAAAAAAATGCAGCCTGG + Intronic
1116919027 14:50553439-50553461 AATTAAAAAAAAATAGATGTTGG + Intronic
1116943320 14:50811958-50811980 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1117153308 14:52911488-52911510 AAATAAACAAAAAATTAGCTGGG + Intronic
1117185142 14:53232617-53232639 AACAATACAAAAATTGAGCTGGG + Intergenic
1117225095 14:53650024-53650046 AATGGAAAAAAAATGAAGCTGGG - Intergenic
1117571428 14:57052680-57052702 TTTTAAATAGAAATGGAGCTGGG - Intergenic
1117595365 14:57321580-57321602 AATTAAAAAAAAATAGAGATGGG - Intergenic
1118300199 14:64608323-64608345 AATTAAAAAAAAAAAAAGCTGGG - Intergenic
1118436898 14:65779746-65779768 AACTTGTCAAAAATGGAGCTGGG + Intergenic
1118537051 14:66778894-66778916 AATTAAAAAAAAAATTAGCTGGG - Intronic
1118612191 14:67550084-67550106 AAATACACAAATACGGAGCTGGG - Intronic
1118626069 14:67660420-67660442 AATTAAACAGAAAAGGAGTCAGG + Intronic
1119292622 14:73507734-73507756 AAATAAAATAAAATGCAGCTGGG - Intronic
1119369212 14:74124132-74124154 AATCAAAAAAGAATTGAGCTAGG + Intronic
1119549794 14:75500251-75500273 AATTAAAAAAAAATAAGGCTGGG + Intergenic
1119575379 14:75716347-75716369 AAATAAACAAACATGAGGCTAGG - Intronic
1120224029 14:81770050-81770072 AATTAAAAAAAAATAGATGTTGG + Intergenic
1120310054 14:82815470-82815492 AATTAAAAAAAAAATTAGCTGGG + Intergenic
1120604618 14:86559187-86559209 AAATAAAAAAAAAATGAGCTGGG + Intergenic
1120648385 14:87100744-87100766 AATTATTCAAAAATGCAGTTGGG + Intergenic
1122057549 14:99114354-99114376 AATTAAAAAAAAAAATAGCTGGG - Intergenic
1122073520 14:99221009-99221031 AAATATAAAAAAATGTAGCTGGG - Intronic
1122729847 14:103787943-103787965 AATTAAAAAAAAAGGAGGCTGGG - Intronic
1122761958 14:104035305-104035327 AATAAATTAAAAATGGAGCTAGG + Intronic
1123168222 14:106346883-106346905 ATTAAAAGAAGAATGGAGCTAGG - Intergenic
1123179134 14:106451536-106451558 AATAATACAAAATTAGAGCTAGG - Intergenic
1123668628 15:22630273-22630295 AAAAAAAAAAAAATGGAGCTGGG - Intergenic
1123714834 15:23020111-23020133 TATTAAAAAAAAATACAGCTGGG + Intronic
1123752926 15:23372662-23372684 AAATAAATAAAAAAGTAGCTGGG + Intergenic
1124016576 15:25881681-25881703 AATAAAACAAAAATACAACTAGG + Intergenic
1124107340 15:26752422-26752444 AAATAAACAAAAAATTAGCTGGG - Intronic
1124524604 15:30436744-30436766 AAAAAAAAAAAAATGGAGCGGGG - Intergenic
1124774049 15:32570966-32570988 AAAAAAAAAAAAATGGAGCGGGG + Intergenic
1125099222 15:35890953-35890975 AAAAACACAAAAATGTAGCTGGG + Intergenic
1125645341 15:41267771-41267793 AAAAAAAAAAAAATTGAGCTGGG + Intronic
1125917187 15:43498828-43498850 AATTATCCAAGATTGGAGCTGGG + Intronic
1125954983 15:43784428-43784450 AATAAAACAAAAATAGAGGGAGG - Intronic
1126427556 15:48545862-48545884 AAATACACAAAAATGTAGCTGGG + Intronic
1126555009 15:49977013-49977035 ATTTAAAAAAAACTGTAGCTGGG + Intronic
1126768131 15:52029304-52029326 AATTAAAAAAAAACAAAGCTAGG - Intronic
1126770947 15:52055244-52055266 CAAAAAACAAAAATGTAGCTGGG + Intronic
1126951276 15:53884486-53884508 AAATAAACAAAAAATTAGCTGGG - Intergenic
1127305359 15:57700424-57700446 AATTAAAAAAAAATTTAGCGGGG + Intronic
1127527674 15:59809858-59809880 AATTAAAAAAAAATAGAGACAGG + Intergenic
1127699962 15:61489371-61489393 ATTAAAACAAAAGTGGAGGTGGG + Intergenic
1128508517 15:68298463-68298485 AATTAAAAAAAAAATTAGCTGGG + Intronic
1128594717 15:68933296-68933318 AGTTAGACATAAATGCAGCTTGG + Intronic
1128808515 15:70552916-70552938 AAACAAACAAAAATGGTGATTGG - Intergenic
1129433669 15:75520309-75520331 AATTTAAAAAAAAAGAAGCTTGG + Intronic
1129511352 15:76125550-76125572 TGTTAAAAAAAAATGGGGCTGGG + Intronic
1129642018 15:77390072-77390094 AATGAAAGAAAACTGAAGCTTGG + Intronic
1129747115 15:78030460-78030482 AATTAAAAAAAAAATTAGCTGGG - Intronic
1130003911 15:80075699-80075721 GTTTAAACAAAAATGGCTCTAGG - Intronic
1130265255 15:82395511-82395533 AAGCAAACAAAAGTGGAGGTTGG - Intergenic
1130749328 15:86693262-86693284 AATTAAAAAAAAATAGATGTCGG - Intronic
1130871033 15:87972555-87972577 AAGTCAAGAAGAATGGAGCTTGG - Intronic
1131884765 15:96900001-96900023 CATTAAACAAGACTGGAGTTTGG + Intergenic
1131944323 15:97602687-97602709 AATCAAACATAAATGGATCAGGG + Intergenic
1132112488 15:99112389-99112411 AATAAAACAAAACTGGAAATCGG + Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133348678 16:5087501-5087523 TTTTAAACAAAAATGGGGTTGGG + Intronic
1133352317 16:5109611-5109633 AATGCAAAAAAAATGTAGCTGGG - Intergenic
1133448261 16:5881248-5881270 AATCAAACATAATTTGAGCTTGG - Intergenic
1133503210 16:6385341-6385363 AATAAAACAAAAATAAAGATGGG - Intronic
1133521842 16:6565761-6565783 AATTAAAGAAAAAGTGAGCTGGG - Intronic
1133694770 16:8251822-8251844 AATTAAACAAAAATAAATATAGG + Intergenic
1133952636 16:10409486-10409508 AATAAAAAAAAAATGGATCAAGG - Intronic
1134759943 16:16705401-16705423 AAATAAAATAAAATGCAGCTGGG + Intergenic
1134766470 16:16763148-16763170 AATTAAAAAAAAAAATAGCTGGG - Intergenic
1134986128 16:18653804-18653826 AAATAAAATAAAATGCAGCTGGG - Intergenic
1135024479 16:18988584-18988606 AAATATACAAAAATTGGGCTGGG - Intronic
1135093908 16:19546858-19546880 AAGTCAACAAAAATGAAGTTTGG - Intronic
1135237509 16:20771363-20771385 AAAAAAAAAAAAAAGGAGCTCGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135315571 16:21441897-21441919 AAATATACAAAAATTGGGCTGGG + Intronic
1135368497 16:21874160-21874182 AAATATACAAAAATTGGGCTGGG + Intronic
1135375773 16:21946019-21946041 AATTAAAACAAAATTGAGCCGGG + Intergenic
1135434741 16:22419282-22419304 AATTTAGCAAAAATGTGGCTGGG + Intronic
1135443320 16:22496984-22497006 AAATATACAAAAATTGGGCTGGG - Intronic
1135449102 16:22542368-22542390 AAATATACAAAAATTGGGCTGGG - Intergenic
1135554704 16:23426382-23426404 AACTAAACAAAAATGGATCAAGG + Intronic
1135578993 16:23609261-23609283 AATTAAATTAAAATTTAGCTGGG + Intronic
1136243254 16:28957647-28957669 AAAAAAAAAAAAATGGAGATGGG + Intronic
1136312256 16:29420641-29420663 AAATATACAAAAATTGGGCTGGG + Intergenic
1136325682 16:29522360-29522382 AAATATACAAAAATTGGGCTGGG + Intergenic
1136440371 16:30262342-30262364 AAATATACAAAAATTGGGCTGGG + Intergenic
1136463612 16:30427303-30427325 AAAAAAACAAAAAAGGGGCTGGG - Intronic
1136464607 16:30433674-30433696 AATTAAAAAAAAAATTAGCTGGG + Intergenic
1136689065 16:32015297-32015319 AAAAAAAAAAAAATGGTGCTGGG + Intergenic
1136770078 16:32829804-32829826 AATAAAACAAATATGCACCTTGG - Intergenic
1136789658 16:32958807-32958829 AAAAAAAAAAAAATGGTGCTGGG + Intergenic
1136880154 16:33895126-33895148 AAAAAAAAAAAAATGGTGCTGGG - Intergenic
1137406332 16:48192449-48192471 AAAAAAATAAAAATGAAGCTGGG + Intronic
1137434402 16:48443766-48443788 AATTTACCAAAAATAGGGCTGGG + Intronic
1138325652 16:56164687-56164709 AGTCATACAAAAATGGAGATGGG + Intergenic
1138639199 16:58369496-58369518 ATTTAAAAAAAAAATGAGCTGGG - Intronic
1138678051 16:58666050-58666072 AAACAAACAAAAAGGCAGCTGGG - Exonic
1138694146 16:58795881-58795903 AATTATACAAGAAATGAGCTGGG + Intergenic
1139063311 16:63282222-63282244 AATAAAAAAAAAATGAATCTAGG - Intergenic
1139200662 16:64973508-64973530 ATTTAAAGAAAAATGCAGCCTGG + Intronic
1139388867 16:66592582-66592604 TATTAGAAAACAATGGAGCTGGG + Intergenic
1139538100 16:67591867-67591889 AATTAAAAAAAAAATTAGCTAGG - Intronic
1139571397 16:67815020-67815042 AATTAAAAAAAAAAAGAGCCGGG + Intronic
1139726627 16:68905238-68905260 AATAAAATAAAATTGGGGCTGGG + Intronic
1139886880 16:70214689-70214711 AAATATACAAAAATTGGGCTGGG + Intergenic
1139947673 16:70652297-70652319 AATTAAAAAAAAAATTAGCTGGG + Intronic
1140516485 16:75546432-75546454 AAACAAAAAAAAATAGAGCTTGG - Intronic
1140662607 16:77201905-77201927 ATTGAAACAAAAATGGAGGGGGG + Exonic
1140670240 16:77270256-77270278 ATTTAAAAAAACAAGGAGCTGGG - Intronic
1141452159 16:84111903-84111925 AAAAAAAAAAAAATGCAGCTGGG + Intronic
1141519714 16:84570316-84570338 AATGAAAGATACATGGAGCTAGG + Intronic
1141748911 16:85945374-85945396 AAATAAAGAAAAATAAAGCTGGG - Intergenic
1141866935 16:86756791-86756813 AATCAAATAAAAATGAGGCTGGG - Intergenic
1203091859 16_KI270728v1_random:1220278-1220300 AAAAAAAAAAAAATGGTGCTGGG + Intergenic
1142662897 17:1443692-1443714 AAATAAAAAAAAGTGGGGCTGGG - Intronic
1143088121 17:4432206-4432228 AAATACACAAAAAAGTAGCTGGG - Intergenic
1143154378 17:4826929-4826951 AATTAGAAAAAAATGTAGGTCGG + Intergenic
1144183879 17:12777903-12777925 AAATAAAAAAAAATTTAGCTGGG - Intergenic
1144190196 17:12838660-12838682 AAATAAACAAAATTGGAGATGGG - Intronic
1144279770 17:13713756-13713778 AAGTAAAAAAAAATCTAGCTGGG + Intergenic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1145856807 17:28167395-28167417 AATTAAAAAAAAAAAAAGCTGGG - Intronic
1146202326 17:30869951-30869973 AATAAAAAAAAAAAGTAGCTAGG + Intronic
1146299366 17:31676260-31676282 AATGAAAGAAAAATGGGGCTGGG + Intergenic
1146314979 17:31799759-31799781 AATTACAAAAAAATTTAGCTGGG + Intergenic
1146568055 17:33930268-33930290 AATGAAACACAAAAGGAGCCAGG - Intronic
1146657377 17:34642695-34642717 TAAAAAACAAAAATGTAGCTGGG - Intergenic
1146860995 17:36298337-36298359 AATTAATAGAAGATGGAGCTAGG - Intronic
1147091326 17:38102441-38102463 AATTAATAGAAGATGGAGCTAGG - Intergenic
1147105886 17:38218064-38218086 AATTAATAGAAGATGGAGCTAGG + Intergenic
1147208482 17:38856398-38856420 AACAAAACAAAAATGGGGCCAGG + Intergenic
1147489782 17:40855136-40855158 AATTAAGAAAAACTGGGGCTGGG - Intergenic
1147942937 17:44062725-44062747 AATAATACAAAAATTGAGCCAGG + Intronic
1148120698 17:45208766-45208788 AATTAAAAAAAAAATTAGCTAGG - Intergenic
1148468653 17:47879756-47879778 AACTAAACAAAAAATAAGCTGGG - Intergenic
1148691714 17:49531480-49531502 AATTAAAAATAAATGAGGCTGGG - Intergenic
1149096644 17:52849147-52849169 AGTTCAACAAAAATAGAGTTGGG + Intergenic
1149700211 17:58648948-58648970 AAAAAAACAAAAATTTAGCTGGG - Intronic
1149905589 17:60523655-60523677 AATTTAAAAAAAATAGAGATGGG - Intronic
1150038189 17:61827431-61827453 AATTTAAAAAAAATGGGGCTGGG + Intronic
1150068940 17:62136351-62136373 AATTATAGAAAAATGAAGCTGGG + Intergenic
1150257949 17:63763856-63763878 AATTAAAAAAAAAAAGAGCAGGG + Intronic
1150338540 17:64347195-64347217 AATTAAAGAAAAATAGAGACAGG - Intronic
1150417615 17:65000091-65000113 AAACAAACAAAAATTTAGCTGGG + Intergenic
1150466887 17:65401190-65401212 AATTAAAAAAAAATTAAGCAAGG - Intergenic
1150484571 17:65534767-65534789 AACAATACAAAAAAGGAGCTGGG + Intronic
1150579375 17:66458372-66458394 AGTTAAACAAAAATGGACACAGG + Intronic
1151434005 17:74082965-74082987 AGTTGAATAAAAAGGGAGCTAGG + Intergenic
1151800010 17:76373428-76373450 AAATAAAAAAAAAAGTAGCTGGG + Intronic
1152486491 17:80597669-80597691 AAATAAACAAAAAATTAGCTGGG - Intronic
1152513634 17:80807650-80807672 AGTTAAAAAAAAAAGGGGCTTGG - Intronic
1152982285 18:289829-289851 AAAAAAAAAAAACTGGAGCTAGG + Intergenic
1153039948 18:803070-803092 AATTAAAAAAAAAATTAGCTGGG + Intronic
1153102818 18:1493811-1493833 ACTTAAAAAAAAATAGAGATGGG + Intergenic
1153175878 18:2372417-2372439 AATTAAAAAAAAATAGATGTTGG - Intergenic
1153627500 18:7035710-7035732 ATTTAAAAAGAAAGGGAGCTGGG - Intronic
1153756069 18:8284587-8284609 AATTAAAAAAAAAATTAGCTAGG + Intronic
1154405754 18:14089785-14089807 CATTAAACAGTAATGGAGATAGG + Intronic
1154447047 18:14444341-14444363 AATTACAAAAAACTGGAGCTAGG + Intergenic
1154982145 18:21511644-21511666 TCTTAAAGAAAAATGGTGCTGGG - Intronic
1155131109 18:22935268-22935290 AAACAAACAAAAATGGATGTTGG - Intronic
1155864511 18:30948501-30948523 AATAAAAAAAAAATAGGGCTGGG + Intergenic
1156325229 18:36068619-36068641 AATTAAAAAAAAATCCAGCTGGG - Intergenic
1156369357 18:36458780-36458802 AATTAAAAGAAAAGGGAGGTGGG - Intronic
1156476057 18:37406125-37406147 AAAAAAATAAAAATGGAGCAGGG - Intronic
1157448487 18:47766943-47766965 AATTAACCCAAAATGGATCATGG + Intergenic
1157517163 18:48318964-48318986 TATTAAAATAAAATGCAGCTGGG - Intronic
1157719899 18:49915675-49915697 AATTAAAACAATATGTAGCTAGG - Intronic
1158302284 18:56065462-56065484 AAAAAAAAAAAAAAGGAGCTGGG - Intergenic
1158356560 18:56626971-56626993 AAAAAAAAAAAAATGTAGCTTGG - Intronic
1158666417 18:59436809-59436831 AATTTAACAAAAATTTAGCCAGG + Intronic
1158711757 18:59843887-59843909 AAAAAAAAAAAAATTGAGCTGGG + Intergenic
1158739068 18:60118513-60118535 TATTAAATAAAAATTGAGCAAGG + Intergenic
1158918101 18:62157162-62157184 AAGTAAATACACATGGAGCTGGG - Exonic
1159062091 18:63526274-63526296 AAATAAATAAAAAGGAAGCTAGG - Intergenic
1159439056 18:68454651-68454673 AAACAAACAAGACTGGAGCTGGG + Intergenic
1159585161 18:70277117-70277139 AGTTAAATAAAACCGGAGCTGGG - Intergenic
1160430116 18:78805121-78805143 AATAAAATAAATATGGGGCTAGG + Intergenic
1161246884 19:3257770-3257792 AAATAAAAAAAAATGGAGGCTGG - Intronic
1161366456 19:3882471-3882493 AATTAACCAAACATGGTGATGGG - Intronic
1161699818 19:5788411-5788433 AAATACACACAAGTGGAGCTTGG + Intronic
1161858479 19:6779708-6779730 AATAAAACTAAAATAAAGCTGGG + Intronic
1161951039 19:7468254-7468276 AAAAAAAAAAAAATGAAGCTGGG + Intronic
1162040416 19:7967800-7967822 AAATCAACAAAAACGGAGTTAGG + Intronic
1162077412 19:8197146-8197168 ATTTAAAAAAAAATGCAGCCAGG + Intronic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1162358148 19:10200120-10200142 AAATAAACAAAAAATTAGCTGGG - Intronic
1162469962 19:10866934-10866956 AATTATACAAAAATTAGGCTGGG - Intronic
1162913663 19:13863368-13863390 AATTAAAAAAAAAATTAGCTGGG - Intronic
1163569973 19:18075554-18075576 AAATAAAATAAAATGGGGCTGGG - Intronic
1163579804 19:18131719-18131741 AATTAAAAATAAATGAAGGTAGG + Intronic
1163741878 19:19019595-19019617 AAATATACAAAAATGTATCTAGG + Intronic
1164947399 19:32308006-32308028 AATTAAACATTTATTGAGCTAGG - Intergenic
1164979377 19:32602239-32602261 AAATAATTACAAATGGAGCTTGG + Intronic
1165385347 19:35507279-35507301 AATGAACCAAAGATGGAGATGGG + Intronic
1165604697 19:37091764-37091786 AAAAATACAAAAATTGAGCTGGG + Intronic
1165613479 19:37177730-37177752 TATTAAAACAAACTGGAGCTGGG + Intronic
1165700182 19:37931587-37931609 AAATAAAAAAAAAAGTAGCTGGG + Intronic
1165851782 19:38853876-38853898 AATTAAAAAAAAAATTAGCTGGG + Intergenic
1166248649 19:41549846-41549868 AATTAAAAAAAAATTGGGCACGG - Intronic
1166413147 19:42570374-42570396 AATTAAACACATATGGACTTTGG - Intergenic
1166414598 19:42585135-42585157 ATTAAAACAAAAATTCAGCTGGG + Intronic
1166516382 19:43450162-43450184 GATAAAATAAAAATAGAGCTGGG + Intergenic
1166549225 19:43654127-43654149 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1166591170 19:44000808-44000830 CCTTATACAAAAATGAAGCTGGG - Intergenic
1167121553 19:47520317-47520339 ATTTAAACAATCATGGAGTTTGG - Intergenic
1167348141 19:48959517-48959539 AAAAAAAAAAAAATGGGGCTGGG + Intronic
1167409121 19:49334657-49334679 AATTAAAAAAAAACAGAGATAGG - Intergenic
1167567056 19:50263224-50263246 AAATAAATAAGAAAGGAGCTTGG + Intronic
1167789806 19:51667554-51667576 AATTGAACAAAGAAGCAGCTAGG + Intergenic
1167908729 19:52684072-52684094 AAAAATACAAAAATTGAGCTGGG + Intronic
1168028664 19:53662562-53662584 AATTGAAAAAAAACGTAGCTGGG + Intergenic
1168513585 19:56992811-56992833 AATTAAACAGACATGGTGGTGGG + Intergenic
925862217 2:8190266-8190288 AATTAAAAGAACATTGAGCTTGG - Intergenic
925894656 2:8462100-8462122 ATCTAGACAAAAATGGAGCTTGG + Intergenic
926822944 2:16873047-16873069 AATGAAACAAAAATATTGCTGGG + Intergenic
927586645 2:24313242-24313264 AATTAAAAAAAAAATTAGCTGGG - Intronic
927699264 2:25257682-25257704 AATTAAACCAAAGTGAATCTGGG - Intronic
927736300 2:25525729-25525751 ATTTAAGTAAAAATGCAGCTGGG - Intronic
927776083 2:25904379-25904401 AATTAAAAAAAAAAGAAACTGGG - Intergenic
928227812 2:29468691-29468713 ATTTGAAAAAAAATGTAGCTGGG + Intronic
928297803 2:30100092-30100114 AATTAAAAAAAAATAGATGTTGG - Intergenic
928329336 2:30345879-30345901 AATTACAAAAAAAATGAGCTGGG + Intergenic
928662832 2:33520854-33520876 AAATAAAAAAAACTGAAGCTTGG - Intronic
928786812 2:34897693-34897715 AATTAAACAAAAGATGAGGTGGG + Intergenic
929378512 2:41320669-41320691 AATTAAACATAGCTGAAGCTTGG + Intergenic
930133810 2:47880454-47880476 AAGTAAACAAGAAAGGAGCCAGG - Intronic
930331028 2:49984003-49984025 AATTAAAAAAAAAATTAGCTGGG + Intronic
930474607 2:51865381-51865403 AATTAAAAAAAAATAGATGTTGG - Intergenic
930582292 2:53226603-53226625 AATTAAAATAAAATAAAGCTTGG + Intergenic
930796663 2:55399366-55399388 AATTAAAAAAAAAATTAGCTGGG + Intronic
931028864 2:58147435-58147457 AATTAAAGACAAATCGTGCTTGG + Intronic
931137571 2:59421090-59421112 AATACAAAAAAAATGTAGCTGGG + Intergenic
931334050 2:61321013-61321035 AAACAAACAAAAAAGTAGCTGGG + Intronic
931363723 2:61600520-61600542 AATTAAGGAAAAGTGGAGATCGG + Intergenic
931728663 2:65133762-65133784 AAAAAAACAAAACTGGGGCTTGG + Intergenic
931829339 2:66034862-66034884 AAGTTCAAAAAAATGGAGCTGGG - Intergenic
932055441 2:68438620-68438642 AATGAAACATAACGGGAGCTTGG + Intergenic
932059095 2:68477478-68477500 AATTAAAAAAAAAATTAGCTAGG + Intronic
932072060 2:68630378-68630400 TATTAAACAAAAAAGTAGGTTGG - Intronic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
933087266 2:78070755-78070777 AATTAGAAAAAAATGGTGTTTGG - Intergenic
933212912 2:79592279-79592301 AATTAAAAAAAAAATTAGCTGGG - Intronic
933257775 2:80100088-80100110 AATACAAAAAAAATGTAGCTGGG - Intronic
933648833 2:84832800-84832822 AATTAAAAAAAAAAGGAGGGGGG + Intronic
933649179 2:84835572-84835594 AATTAAATAAAAATTTAGCTAGG - Intronic
933678858 2:85080874-85080896 TATTAAACAAAAAAGAAGCCAGG - Intergenic
933871021 2:86565315-86565337 AATTAAATAAAAATAGGGCTGGG - Intronic
933890530 2:86764932-86764954 AGTAAAACAAAAAAGGGGCTTGG - Intronic
934673631 2:96233537-96233559 AATTGAAAAAAAATGGAGGCCGG - Intergenic
935100647 2:99992011-99992033 GATTAAAAAAAAAAGGAACTTGG + Intronic
935189965 2:100769312-100769334 AATAAAAGAACAATGGAGGTGGG + Intergenic
935332459 2:101987003-101987025 AATTAAAAAAAAAATTAGCTGGG + Intergenic
935467607 2:103417371-103417393 AAAAAAAAAAAAATGGTGCTTGG + Intergenic
935555036 2:104500405-104500427 AATTTAACAAAAATAAAGTTGGG + Intergenic
935990422 2:108714272-108714294 AAATAAAAAAAAATTTAGCTGGG + Intergenic
936116190 2:109705107-109705129 AAATAAATAAAAATGGGGCCAGG + Intergenic
936456196 2:112676069-112676091 AATTAAACAAAAAAGGATCTGGG + Intergenic
938486352 2:131713622-131713644 AAAAAAAAAAAATTGGAGCTAGG - Intergenic
938637551 2:133245903-133245925 AAAAAAAAAAAAATGGAGGTGGG + Intronic
938745897 2:134277983-134278005 ACTTAAACTAAAAGGGAACTTGG + Intronic
939358165 2:141131827-141131849 AATTAAAAAAAAATGCTGTTTGG - Intronic
939680486 2:145125301-145125323 AATTAAAAAAAAATGCATCATGG + Intergenic
939998378 2:148941585-148941607 AGTTAAAAACAAATTGAGCTTGG - Intronic
940185849 2:150984386-150984408 CTTTAAACAAAAATGTAGCCAGG - Intergenic
940679155 2:156762382-156762404 AATTAAAAAAAAATAGATATTGG + Intergenic
940766998 2:157800454-157800476 AATTAAAAACAAATAGAGATGGG - Intronic
940834800 2:158509095-158509117 AATGACACAAAAATGCATCTTGG + Intronic
940860192 2:158763220-158763242 AAATAAACAAAAAATTAGCTGGG + Intergenic
941381776 2:164801610-164801632 AATTAAAAAAAAATTGAGATAGG - Intronic
941494873 2:166187220-166187242 AATTAAAAAAATAAAGAGCTAGG + Intergenic
941844542 2:170120102-170120124 ATTCAAACAAAAATGGTGCGTGG - Intergenic
941969638 2:171335946-171335968 ACTTAAAAAAGAATAGAGCTTGG + Intronic
942218693 2:173747981-173748003 AATTTAGCAAAAATTTAGCTGGG + Intergenic
942306289 2:174610637-174610659 GATTAAACAAAACTCAAGCTGGG + Intronic
942316671 2:174702724-174702746 AAATAAACAAAAAAGGAGCCTGG - Intergenic
942744945 2:179221315-179221337 AAAAAAAAAAAAATGGGGCTGGG + Intronic
942777592 2:179602492-179602514 ACTTAAAAAAAAAAGAAGCTGGG - Intronic
942787526 2:179716967-179716989 AATTCAACAAAAATTCAGCTGGG - Intronic
943267378 2:185751131-185751153 AAGTAGACAGAAATTGAGCTAGG - Intronic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
943988356 2:194653532-194653554 AAGTGAACAAAAATTAAGCTAGG + Intergenic
944321743 2:198353114-198353136 AATTAACTAAAAATGTAGATTGG - Intronic
944579609 2:201120179-201120201 AAAAAAAAAAAAATGTAGCTGGG - Intronic
944639351 2:201707424-201707446 AAAAAAAAAAAAATGTAGCTGGG - Intronic
944754952 2:202751609-202751631 AAATATACAAAAATTTAGCTGGG + Intronic
945179712 2:207079443-207079465 TATAAAACAAAAATGGCGCTTGG - Exonic
945474827 2:210268964-210268986 AATTAAATGAAAAAGGAGATTGG + Intergenic
945751995 2:213798726-213798748 AATTAAATAAAAATGGATCACGG - Intronic
945853792 2:215042395-215042417 AATAAAATAAAAAAGTAGCTGGG - Intronic
945991194 2:216396629-216396651 AAAAAAAAAAAAATGTAGCTGGG + Intergenic
946841855 2:223827541-223827563 AAATAAAAAAAAATGTAGCTGGG - Intronic
946948486 2:224847106-224847128 AATAAAATAAAAATGGATCTAGG + Intronic
947108095 2:226689039-226689061 AATTAAAAAATAATGGATGTTGG + Intergenic
947374614 2:229483010-229483032 AATTAAACAATAATGTCTCTGGG + Intronic
947382801 2:229561645-229561667 TATTAAACAGAAATGTAGCACGG - Intronic
947445434 2:230159249-230159271 AACTAAATAAAAAAGCAGCTGGG - Intergenic
947761535 2:232606911-232606933 AATTAAAAAAAAATAAAGTTGGG + Intronic
947764135 2:232625025-232625047 AAATAAATAAAAATCTAGCTTGG - Intronic
947776642 2:232717149-232717171 TATTTAACACAACTGGAGCTGGG + Intronic
947787597 2:232837613-232837635 AATAAAAAAAAAAAGTAGCTGGG - Intronic
948093946 2:235318669-235318691 AAAAAAAAAAAAATGTAGCTAGG + Intergenic
948184671 2:236011578-236011600 TATTAAACAAAAAGGCAGCAGGG - Intronic
948249854 2:236518384-236518406 CATAAAACAAAAGTGAAGCTAGG + Intergenic
948411774 2:237768737-237768759 AATTAGAGAAAAATGTAACTTGG + Intronic
1168922626 20:1553058-1553080 AATTAAAGAACAGTGGGGCTGGG + Intronic
1169846673 20:10000803-10000825 AATTAAATTAAAAAGTAGCTCGG + Intronic
1169938866 20:10915357-10915379 AAATAAAAAAAAATTTAGCTGGG + Intergenic
1170187079 20:13602933-13602955 TATTAAAGAAAAATGGGGCCAGG + Intronic
1170271845 20:14536032-14536054 AAATAAAAAATAAAGGAGCTGGG + Intronic
1170274527 20:14569656-14569678 AATCAAAGTAAAATGGAGTTAGG + Intronic
1170497140 20:16936870-16936892 AATAAAACAAATATGGAAATAGG - Intergenic
1170666127 20:18387748-18387770 AATGATACAAACATGGAACTAGG + Intronic
1170923953 20:20705496-20705518 AATTAAAAAAAAATCAAGCTGGG - Intronic
1171049993 20:21848986-21849008 AATTAAAAAAAAAAATAGCTGGG - Intergenic
1171062082 20:21974880-21974902 AATTAAAAAAAAATAGATGTTGG - Intergenic
1171418604 20:25000964-25000986 AATTAAAAAAAAAATTAGCTGGG - Intergenic
1171537509 20:25908809-25908831 AATAAAACAAAAAATTAGCTGGG - Intergenic
1171840458 20:30204143-30204165 AATAAAACAAAAAATTAGCTGGG - Intergenic
1172041601 20:32050564-32050586 ACTTAAAAAAAAATAGAGATGGG - Intergenic
1172147481 20:32766872-32766894 AATTAAAAAAAAATTGAATTTGG - Intronic
1172203956 20:33148792-33148814 TATTCAACAAATATGGAGCCAGG + Intergenic
1172256718 20:33525178-33525200 AAAAAAAAAAAAATGGAGGTAGG - Intronic
1172347229 20:34211188-34211210 CATTAAATAAAAATCGAGCCAGG - Intronic
1172524939 20:35594924-35594946 AAAAAAAAAAAAATGGAGATGGG - Intergenic
1172533028 20:35647013-35647035 AATTAAAAAAAAATAGGGCCGGG + Intronic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1172585266 20:36078897-36078919 AACAAAACAAAAATGGAGGCTGG + Intergenic
1172761015 20:37322107-37322129 AATAAAAAATAAATGGTGCTTGG - Intergenic
1173815335 20:45984105-45984127 AATTAAAAAAAAATAGAGATGGG + Intergenic
1173893915 20:46535370-46535392 AATTAACTCAAAATGGAGCCTGG + Intergenic
1174057493 20:47808347-47808369 AATTAAATAAAATTAGAGATGGG - Intergenic
1174134512 20:48370048-48370070 AATTAAAAAAAAAAGTAGTTTGG + Intergenic
1174235128 20:49083415-49083437 AATTAAATAAAAAATTAGCTGGG - Intronic
1174800353 20:53558072-53558094 AATAAAATAAAAATTGGGCTGGG + Intergenic
1175842059 20:62034482-62034504 AATTAAAAAAAAATTTAGCCAGG - Intronic
1176408597 21:6435564-6435586 ACTTAAAAAATAATGTAGCTGGG + Intergenic
1176992099 21:15509260-15509282 GATAAAACAGAAATGGAGCTAGG + Intergenic
1177087111 21:16719305-16719327 ATATACACAAAAATGGAGTTTGG + Intergenic
1177289147 21:19087609-19087631 AATGAAACAATAATTTAGCTTGG - Intergenic
1177307101 21:19332803-19332825 TATTAAAAAAAAATTTAGCTGGG + Intergenic
1177403953 21:20642155-20642177 AATTAAAAAAAAAACAAGCTTGG + Intergenic
1177716663 21:24847335-24847357 AATTAAAAAAAAATCGATGTTGG - Intergenic
1178371578 21:32031417-32031439 AACTCAACAGAAAAGGAGCTGGG + Intronic
1178721112 21:35009830-35009852 GACTAACCAAACATGGAGCTTGG + Intronic
1178985847 21:37302304-37302326 AATTTAACTAAAATTTAGCTTGG - Intergenic
1179165524 21:38932540-38932562 AAATAAATAAAAATAGAGATAGG - Intergenic
1179319384 21:40275167-40275189 AATTAAAAAAAAAAAAAGCTGGG + Intronic
1179399867 21:41073967-41073989 CATTAAGCAAAAATGTATCTGGG - Intergenic
1179900907 21:44393656-44393678 AATTAAAAAAAAAAGGCACTGGG - Intronic
1180250573 21:46584299-46584321 AAATTAACAAAACTGTAGCTAGG + Intergenic
1180511459 22:16095103-16095125 AATTAAAAAAAAAATTAGCTTGG - Intergenic
1180941299 22:19661025-19661047 AATTAAAAAAAAAATTAGCTGGG + Intergenic
1180946747 22:19698667-19698689 AAATAAACAAAAAGGGAAATGGG + Intergenic
1181076373 22:20380253-20380275 AATTAAAAAAAAAATTAGCTGGG + Intronic
1181972120 22:26698801-26698823 TATTCAACAAAAATGGAACCAGG - Intergenic
1182284584 22:29237638-29237660 AATACAAAAAAAATGTAGCTGGG + Intronic
1182309812 22:29396642-29396664 AATTAAAAAAAAATAGAGGTTGG + Intronic
1182375733 22:29846346-29846368 AAAGAAAAAAGAATGGAGCTAGG + Intergenic
1182570931 22:31237265-31237287 AAAAAAAAAAAAATGGAGGTTGG + Intronic
1182970820 22:34574729-34574751 AATTAAAAAAAAAATTAGCTGGG - Intergenic
1183539297 22:38420253-38420275 AAAAAAAAAAAAAAGGAGCTGGG - Intergenic
1183942783 22:41305510-41305532 AAAAAAACAAAAATGGAGACTGG + Intronic
1185387438 22:50541621-50541643 AAGTAAACTAAAATGGAGACCGG + Intergenic
949454537 3:4224715-4224737 CATGAAAAAAAAATGGACCTTGG + Intronic
949697210 3:6712333-6712355 TATGAAATAAAAGTGGAGCTGGG - Intergenic
949958060 3:9286487-9286509 ATTTAAAAAAAAATAGAGATGGG - Intronic
949979070 3:9488692-9488714 AATTAAAAAAAAATAGAGACAGG - Intergenic
950291193 3:11785774-11785796 AAGTAAACAAAAAATTAGCTGGG - Intergenic
950685171 3:14612010-14612032 AAATAAACAAAAAACAAGCTTGG - Intergenic
950749561 3:15118146-15118168 AATTAGAAAAAAATTTAGCTGGG - Intergenic
951128563 3:19013874-19013896 AATTAAGCAAATATGAAGCATGG + Intergenic
951189703 3:19753908-19753930 ATTTAAAAAAAAATGGAAGTGGG + Intergenic
951318331 3:21214332-21214354 AATAAAATAAAAATGGTGCTGGG - Intergenic
951356825 3:21677358-21677380 AAATATACAAATCTGGAGCTTGG + Intronic
951404586 3:22279938-22279960 AATTAAAAAATAATGGATGTTGG - Intronic
951534351 3:23727882-23727904 CATTAAACAAAAAGGGAGGCTGG - Intergenic
951671286 3:25185141-25185163 AATTAAAAAAAAATATATCTTGG - Intronic
951864955 3:27298005-27298027 ACATAAGCAAAACTGGAGCTTGG + Intronic
952115775 3:30179962-30179984 AATAAAACAGAAGTGGAGATTGG - Intergenic
952120296 3:30234082-30234104 AAACAAACAAATATAGAGCTTGG + Intergenic
952226637 3:31383336-31383358 ACTTAAAAAAAAATGGAGTCTGG - Intergenic
952517319 3:34118603-34118625 AATAAAAAAAAAATAGAGTTAGG - Intergenic
952652320 3:35740939-35740961 AATTAAAAAAAAAAATAGCTGGG + Intronic
952808355 3:37378634-37378656 AAATAAAAAAAAAATGAGCTGGG + Intergenic
952845991 3:37688698-37688720 CATTAAACAAAAATGGGGGGTGG - Intronic
952857837 3:37786822-37786844 AAACAAACAAAAATAGTGCTTGG - Intronic
953584727 3:44189277-44189299 AAGTAGACCAAAATGGAGCTTGG + Intergenic
953589695 3:44239684-44239706 TATTAAAAAAAAAATGAGCTGGG + Intergenic
954184847 3:48909040-48909062 AATTAATCAAAATTGAGGCTTGG - Intergenic
954187659 3:48931243-48931265 AATTAAACAAAAATTTATTTTGG + Intronic
954350193 3:50036940-50036962 AATTAAAAAAAAAATTAGCTGGG - Intronic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
954860953 3:53689953-53689975 AATTAAAAAAAAATCTAGCCGGG - Intronic
955057363 3:55468340-55468362 AAGTGAACAGAAATGGAGGTTGG + Exonic
955091416 3:55754946-55754968 AGTTAAACAAAAGTGGAGGTGGG + Intronic
955130639 3:56163680-56163702 AAACAAACAAAAAAGGAGCAGGG - Intronic
955244370 3:57210889-57210911 AATTTAATAAAAATTGAGATAGG + Intronic
955431353 3:58848165-58848187 AATTAAAAAAAAAAAGGGCTTGG + Intronic
955915269 3:63901594-63901616 AAAAAAACAAAAATAGAGATAGG + Intronic
955922401 3:63971237-63971259 AATTAGCCAAAATTGGGGCTGGG - Intronic
956003499 3:64753885-64753907 AAGTAAATGAAAATGGAACTGGG - Intergenic
956800692 3:72755354-72755376 AATAAAATAGAAATGAAGCTTGG - Intronic
957053024 3:75424852-75424874 TTTTAAACAAAACTGGGGCTGGG + Intergenic
957067261 3:75535093-75535115 AAATAAACAAAAATAGGGCCGGG - Intergenic
957208407 3:77229498-77229520 AATTAAAAAAAAATATAGCCAGG + Intronic
957325520 3:78687924-78687946 AATAAAACAAAAACGCGGCTGGG - Intronic
957651261 3:83008165-83008187 AAATAAACAAAAATGGTAATAGG - Intergenic
957697542 3:83660722-83660744 ATTTAAAAAAGAATGGTGCTAGG + Intergenic
957704719 3:83765608-83765630 AATTAAAAAAAAAATTAGCTAGG + Intergenic
957764361 3:84602642-84602664 AAATAAACAATACTGGAGCAAGG - Intergenic
957804487 3:85129728-85129750 AATTCAAGAAAAATGGAGAAGGG - Intronic
958027546 3:88066411-88066433 AAAAAAACAAAAATTTAGCTGGG + Intronic
958105527 3:89067798-89067820 CATTAAATAAAAATGACGCTTGG + Intergenic
959424254 3:106166753-106166775 AATTAAAAAAAAATAGATGTTGG + Intergenic
959701078 3:109299523-109299545 AATAAAATAAAAATTTAGCTGGG + Intronic
960112468 3:113858385-113858407 AAAAAAAAAAAAATGTAGCTGGG - Intronic
960646461 3:119889924-119889946 AATTAAACAAAAATAAAGAGGGG + Intronic
960650167 3:119939154-119939176 AACTCAACAAAAATAGAGCAGGG + Intronic
961171538 3:124801080-124801102 ATCTCAACAAAAAAGGAGCTGGG + Intronic
961285890 3:125802873-125802895 AAATAAACAAAAATAGGGCCGGG + Intergenic
961301813 3:125926685-125926707 TTTTAAACAAAAATGGGGCTGGG - Intergenic
961886654 3:130101153-130101175 TTTTAAACAAAAATGGGGCTGGG + Intronic
961900852 3:130210029-130210051 AAATAAACAAAAATAGAGCTGGG - Intergenic
961947019 3:130701836-130701858 CATTAAAAAAAAATGGGGCCAGG + Intronic
962101516 3:132347638-132347660 AATTTAAAAAAAATTTAGCTGGG - Intronic
962224915 3:133597737-133597759 AAGAAAAAAAAAATTGAGCTGGG + Intergenic
962468515 3:135683802-135683824 AGTTAAAAAATAATGGTGCTGGG + Intergenic
962542303 3:136394949-136394971 AAAAAAAAAAAAATGTAGCTAGG + Intronic
962577234 3:136766095-136766117 AAATAAACAAAAAAATAGCTGGG + Intergenic
962712393 3:138098986-138099008 AATTAGACAAACATGGTGGTAGG + Intronic
962804425 3:138916506-138916528 AAATAAATAAAAAAGGAGCCAGG + Intergenic
963017135 3:140835337-140835359 GATTAAACAAAGCTGGAGATTGG + Intergenic
963197399 3:142547888-142547910 AATGAAACAGAAATTGAACTGGG - Exonic
963224920 3:142852815-142852837 AAATTAACAAAAATGGTGCCAGG + Intronic
963225892 3:142861263-142861285 AATTTAACAAAGATGCACCTTGG + Intronic
963301484 3:143602031-143602053 ATTTAAACAAAAAAGGACATGGG - Intronic
963431806 3:145216499-145216521 ATTTAAAAAAAAATGGAGTCAGG - Intergenic
963499674 3:146109680-146109702 AATTAAATAAAATTTGACCTTGG - Intronic
963635906 3:147795272-147795294 AATTAATAAAAAATGAAGTTTGG + Intergenic
963677237 3:148327718-148327740 AATTAAAGAAAACTGTAGATAGG - Intergenic
963820319 3:149884582-149884604 AACTAAAAAAAAATGTAGATGGG - Intronic
963870065 3:150407300-150407322 AGTTAAAAAAAAATGGGGATGGG - Intergenic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
964589566 3:158345065-158345087 AAAAAAAAAAAAATGTAGCTGGG + Intronic
964904042 3:161696039-161696061 AATTTCACAGAAATAGAGCTTGG + Intergenic
965194975 3:165582584-165582606 AATTAAATAAAAATGGTAATGGG - Intergenic
965479504 3:169200389-169200411 AATTAAATAAAAAGTGAGTTTGG - Intronic
965535664 3:169821472-169821494 AATTACAAAAAAATTTAGCTGGG + Intergenic
965646812 3:170892266-170892288 AAATACACAAAAAAGTAGCTGGG + Exonic
965664610 3:171079712-171079734 AATTAGAAATAAATGGAGGTGGG - Intronic
965843353 3:172932912-172932934 AAATATACAAAAATTGATCTTGG - Intronic
966037653 3:175439495-175439517 AATTAAAAAAAAATAGATGTTGG - Intronic
966164309 3:176999965-176999987 AATTAAAAAAAAATAGAGGCAGG - Intergenic
966288437 3:178325418-178325440 AATTAAACAATGATTGAGGTTGG - Intergenic
966328820 3:178788647-178788669 AATTACTAAATAATGGAGCTGGG + Intronic
967161811 3:186745859-186745881 AATTAAAAAAAAAATTAGCTTGG + Intergenic
967555900 3:190858404-190858426 AAATAAATAAAAATAGAGGTGGG + Intronic
967925685 3:194644631-194644653 GATGAAATAAAAATGCAGCTAGG - Exonic
967959633 3:194910117-194910139 AATTAAAAAAAAAAGCAGCTAGG - Intergenic
968157969 3:196398790-196398812 AATTAAGAAAAAAATGAGCTGGG - Intronic
968296916 3:197583794-197583816 AAGAAAACAAAAATACAGCTTGG - Intergenic
968458590 4:712285-712307 AATTCTACAAAAATGCACCTAGG - Intronic
968995821 4:3945170-3945192 TTTTAAACAAAAATGGGGCTGGG + Intergenic
969392320 4:6900191-6900213 AAAAAACCAAAAATGTAGCTGGG + Intergenic
969758160 4:9163554-9163576 TTTTAAACAAAAATGGGTCTGGG - Intergenic
970150467 4:13083708-13083730 TATTTAACAAAAATGGAGATGGG - Intergenic
971085266 4:23267588-23267610 AAATAAAAAGAAATGGAGATGGG + Intergenic
971161304 4:24136818-24136840 AATTAAGGTAAAATGGACCTGGG + Intergenic
971467563 4:26980057-26980079 ATTTAAAGAAAAGTGGGGCTGGG - Intronic
972399179 4:38684712-38684734 AAAAAAACAAAAATGTAGCGGGG - Intronic
972648566 4:40993543-40993565 AAATAAACAAAAAATTAGCTGGG - Intronic
972859393 4:43148795-43148817 AAAAAAAAAAAAATAGAGCTGGG - Intergenic
973238531 4:47932334-47932356 AAAAAAAAAAAAATGTAGCTAGG + Intronic
973286207 4:48419557-48419579 AAACAAACAAAAAGGCAGCTGGG - Intronic
973329309 4:48896430-48896452 AATTAAAAAAAAAATTAGCTGGG + Intronic
973533216 4:51853657-51853679 AATTAAATAAAAATGGGTGTGGG - Intronic
973756865 4:54083315-54083337 AATTTAACAGAAATTGAGATTGG - Intronic
974224974 4:59028966-59028988 AATTAAAAAAAAATGGACGTAGG + Intergenic
974239482 4:59228034-59228056 AATTAAACTGAAATGAAGCAAGG - Intergenic
974361361 4:60884940-60884962 AATCAAAGAAAATTAGAGCTGGG + Intergenic
974434454 4:61839349-61839371 AATTAAAAAAAAAATTAGCTGGG - Intronic
974641828 4:64641088-64641110 AATTAAACTAAAATGCAATTAGG + Intergenic
974725207 4:65789889-65789911 AATTCAGAAAAAATGGAGCCTGG + Intergenic
974730335 4:65856089-65856111 AATTGACCAAAAATGAAACTTGG - Intergenic
974733853 4:65902506-65902528 AAAGAAACAAATATGGGGCTGGG - Intergenic
974881233 4:67759869-67759891 ATTAAAACAAAGATGAAGCTTGG + Intergenic
975207571 4:71662625-71662647 AATTAAAAAAAAAAAAAGCTGGG - Intergenic
975426867 4:74239539-74239561 AATTAAACAAAAATAAATGTGGG - Intronic
975642994 4:76518920-76518942 AGTGGAACAAGAATGGAGCTAGG + Intronic
975793444 4:77982091-77982113 AATTAAAAAAAAATGGACCTGGG - Intergenic
975851563 4:78578118-78578140 AATTAAAAAAAAAATTAGCTGGG + Intronic
976167442 4:82270782-82270804 AATTAAAATATAATGGAGCACGG + Intergenic
976241689 4:82964522-82964544 ATTTCAACCAAAATGGAGGTTGG + Intronic
976308332 4:83583685-83583707 AAAAAAAAAAAAATGAAGCTGGG + Intronic
976419402 4:84822536-84822558 ATTTAAAAAAAAATTTAGCTGGG + Intronic
976489175 4:85647825-85647847 AATAAAGCAAAAATGGACATAGG - Intronic
976606215 4:86985513-86985535 AAAAAAAAAAAAATGTAGCTCGG + Intronic
977116114 4:93031023-93031045 AAAAAAAAAAAAATGGAGATTGG - Intronic
977451328 4:97201726-97201748 AATAAAAGAAAAATGGGGCTGGG - Intronic
977809056 4:101337689-101337711 AACAAAAATAAAATGGAGCTTGG + Intronic
977834115 4:101629075-101629097 AATTAAAAAATAATGGATCTTGG + Intronic
978130137 4:105186067-105186089 AAATAAACAAAAAATGTGCTGGG + Intronic
979234355 4:118383053-118383075 AAATAAATAAAACTGGACCTAGG - Intergenic
979357393 4:119721102-119721124 AAATAAAAAAAAATAGATCTTGG + Intergenic
979392812 4:120146835-120146857 AATTAAAAAAAAAAAAAGCTGGG - Intergenic
979619795 4:122786263-122786285 AATTTAAAAAAAAAGGAGATTGG + Intergenic
979946137 4:126833688-126833710 TTTTAAAAAAAATTGGAGCTGGG + Intergenic
980066811 4:128198179-128198201 TATTAAACTACAATGGGGCTGGG - Intronic
980115414 4:128674216-128674238 AAATAAACAAAAAATTAGCTGGG - Intergenic
980546197 4:134266305-134266327 AATTTAAAAAAAATAGAGATGGG - Intergenic
980553715 4:134374335-134374357 AATTAAAAGAATATGGAACTGGG + Intergenic
980610173 4:135150574-135150596 AAATAAATAAAAAGAGAGCTAGG - Intergenic
980839354 4:138238758-138238780 AAATACACAAAAATTTAGCTGGG - Intronic
980895877 4:138859721-138859743 AAATTAACACAAATGGAGCTGGG - Intergenic
981181776 4:141754673-141754695 AATTAAACAAGAATTACGCTTGG - Intergenic
981706236 4:147662205-147662227 AACTAAACACAAAAGAAGCTAGG + Intronic
981890751 4:149733514-149733536 AATAAAACAAAAATAGATTTTGG + Intergenic
981904403 4:149904223-149904245 AATTTAACAAAAATGTAATTGGG - Intergenic
981960594 4:150533470-150533492 AATTAAAAAAAAATGGGTTTTGG - Intronic
981961824 4:150550371-150550393 AAAGAACCAAAAATGGATCTAGG + Intronic
981992087 4:150933862-150933884 AATAAAACAAAAAATTAGCTGGG + Intronic
981999805 4:151011833-151011855 AATTAAATAAAAAATTAGCTGGG - Intronic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982216734 4:153088755-153088777 AGTAAAAACAAAATGGAGCTGGG - Intergenic
982362176 4:154530760-154530782 AAAAAAACAAAAACAGAGCTGGG + Intergenic
982769579 4:159384185-159384207 AATTAAAAAAAAATTGAAATTGG - Intergenic
983209245 4:164941747-164941769 AAATAAAAATAAATGGTGCTGGG + Intergenic
983958841 4:173728019-173728041 AAAAAAACAAAACTGCAGCTAGG + Intergenic
984126680 4:175818829-175818851 AGCAAAACAAAAAGGGAGCTGGG + Intronic
984129240 4:175852436-175852458 AATGAAACAAGAATGAAGATAGG - Intronic
984141020 4:176003799-176003821 AAATAAACAAAAAATTAGCTTGG + Intergenic
984143922 4:176038069-176038091 AATTTAATAAAAATGGATGTTGG - Intergenic
984521297 4:180804331-180804353 AATTAAACAAAAATGACAATTGG + Intergenic
985235891 4:187873501-187873523 AATTAAAAAAAAATAGATGTTGG - Intergenic
985320977 4:188710904-188710926 AAAAAAACAAAAATTTAGCTGGG + Intergenic
986437190 5:7745881-7745903 TATTAAAGAAACATAGAGCTGGG + Intronic
986504677 5:8436924-8436946 AAATAAAGACAAATGGAGATTGG - Intergenic
986697221 5:10368479-10368501 AAATAAAGAAAAATTTAGCTGGG + Intronic
987110600 5:14682701-14682723 AATAAAAATAAAATGCAGCTAGG - Intronic
987441254 5:17959853-17959875 AACTAAACAAAAATGGAAATGGG + Intergenic
988327113 5:29784431-29784453 AATTAAGCAATTATGAAGCTGGG - Intergenic
988575168 5:32415922-32415944 AACTGAACAAAAAATGAGCTTGG - Intronic
988817209 5:34846262-34846284 AATTAAAAAAAAAAATAGCTGGG + Intronic
988987818 5:36637900-36637922 AATTGATCTGAAATGGAGCTTGG + Intronic
989043606 5:37252924-37252946 AATTAAAGAAAAATTGAACAAGG - Intergenic
989050723 5:37317191-37317213 AATAAAGTAAAAATGGGGCTGGG + Intronic
989498262 5:42134879-42134901 AATTAAACAAAAATCATGTTCGG + Intergenic
989560995 5:42851194-42851216 TATTAAACAAAAATGGAAAGTGG + Intronic
989782683 5:45288253-45288275 ATTTAAAAAGAAATGGAGGTAGG - Intronic
990126581 5:52526245-52526267 AATAAAAGAATAAAGGAGCTGGG - Intergenic
990220151 5:53579553-53579575 AATCAAATAAAAATTTAGCTAGG + Intronic
990286315 5:54303781-54303803 AACAAAACAAAACTGGGGCTTGG + Intronic
990544636 5:56810713-56810735 AATTAAAAAAAAAATTAGCTGGG - Intergenic
990998098 5:61753542-61753564 ATTTAATAAAAAATGGAGGTGGG + Intergenic
991071424 5:62486139-62486161 AAATAAACAAAAAATTAGCTGGG - Intronic
991087573 5:62662028-62662050 AATTAAAAAAAAAATTAGCTGGG - Intergenic
991202663 5:64012437-64012459 AATTAAAAAAAAAAGAAGCATGG + Intergenic
991355360 5:65763692-65763714 AATTAAACAAAAAAAAAGCCTGG - Intronic
991407592 5:66316706-66316728 AAATAAAAAAAAATGGGGTTGGG - Intergenic
991499365 5:67261424-67261446 AATTTAACAAAAAAGGAGGATGG - Intergenic
991529025 5:67595083-67595105 AATTGCATAAAAAGGGAGCTAGG + Intergenic
991548726 5:67813003-67813025 AATTAAAAAATAATAGATCTTGG + Intergenic
991615139 5:68489177-68489199 AACTAATCAGAAATGGAGCCAGG + Intergenic
991635927 5:68705475-68705497 AAATAAACAAAATTGTATCTTGG + Intergenic
991766200 5:69983008-69983030 AAATAAAAAAAAAAGGAGCCAGG + Intergenic
991781119 5:70135146-70135168 AAATAAAAAAAAAAGGAGCCAGG - Intergenic
991845434 5:70858092-70858114 AATAAAAAAAAAAAGGAGCCAGG + Intergenic
991873564 5:71135460-71135482 AAATAAAAAAAAAAGGAGCCAGG - Intergenic
991878166 5:71196864-71196886 TTTTAAAAAAAAAAGGAGCTGGG - Intergenic
991901952 5:71469772-71469794 AAATAAAAAAAAAATGAGCTGGG - Intronic
992121160 5:73594192-73594214 AAATAAACAAAAAATTAGCTGGG + Intergenic
992342642 5:75841215-75841237 TAATAAAAAAAAATGGTGCTGGG - Intergenic
992614706 5:78536886-78536908 AATTCAACAAAAATTGAGCAGGG + Intronic
992909715 5:81384078-81384100 ACTTAACCATGAATGGAGCTTGG - Intronic
993105520 5:83596154-83596176 AATTAAACCAAAGTGGAGAAAGG - Intergenic
993115346 5:83714004-83714026 AAGGAAACAAAAACAGAGCTGGG + Intronic
993118112 5:83741828-83741850 AAGCAAAGGAAAATGGAGCTGGG + Intergenic
993283371 5:85957961-85957983 AATTAAAAAAAAATAGATCATGG + Intergenic
993432354 5:87847425-87847447 CTTTAAAAAAAAATGTAGCTTGG - Intergenic
993725294 5:91359987-91360009 ATTAAAAAAAAAATAGAGCTGGG + Intergenic
993841244 5:92881889-92881911 ACTTAAACAAAAATGGTCATGGG - Intergenic
993910315 5:93674406-93674428 GATTAATCAAAAATGTATCTTGG + Intronic
994177190 5:96723798-96723820 AATTTAATAATAATGGAGTTGGG - Intronic
994280518 5:97897138-97897160 AATTAAAAAAAAAAAGAACTCGG - Intergenic
994679973 5:102874139-102874161 AAATAAACAAAAAAAGGGCTTGG - Intronic
994715902 5:103321201-103321223 ATGTAAACAAAAATGAGGCTGGG - Intergenic
994805110 5:104436587-104436609 TATTATTCAAAAATGGTGCTTGG - Intergenic
995102232 5:108326440-108326462 AATTAAAAAAAAAATGAGCTGGG + Intronic
995503490 5:112834097-112834119 AAATAAAAAAAAAATGAGCTGGG - Intronic
995654250 5:114407022-114407044 AAATAAATAAAAAAGGAGCATGG - Intronic
995832352 5:116367142-116367164 AAATTTACAAAAAGGGAGCTGGG - Intronic
996062933 5:119051896-119051918 AATAAAATAAAAATTTAGCTGGG + Intronic
996195392 5:120600140-120600162 AATTAAACAAAAATGGAGCTGGG - Intronic
996243455 5:121229995-121230017 AAAAAAAAAAAAATGGAGTTGGG - Intergenic
996646620 5:125825709-125825731 AATTAAATAACAATAGAGCTGGG + Intergenic
996802443 5:127419038-127419060 AAATAAACAAAAATATATCTTGG - Intronic
996857408 5:128024565-128024587 AATCAAATCAGAATGGAGCTAGG + Intergenic
997191708 5:131943815-131943837 AGTTAAAAAAAAATAGAACTTGG + Intronic
997636433 5:135409970-135409992 AATTAAAAAAAAAATGAGTTAGG + Intergenic
997917495 5:137942656-137942678 AATTAAAAAAAAATCTAGCCAGG - Intronic
997991438 5:138547486-138547508 AATTAAAAAAAAATTTAGCTGGG + Intergenic
998355979 5:141537005-141537027 ATTTAAAAAAAAATTTAGCTGGG + Intronic
999151143 5:149427026-149427048 AAAAAAACAAAAACAGAGCTGGG - Intergenic
999277607 5:150341836-150341858 AATTAAAAAAAAGGGGAGCCTGG - Intergenic
1000392383 5:160737674-160737696 AATTAACCAAAGATGTAGGTTGG + Intronic
1000414751 5:160972118-160972140 CTTTAAAAAAAAATGGAGCCAGG - Intergenic
1000441883 5:161273052-161273074 AATTAAACAATTTTGAAGCTAGG + Intergenic
1000451105 5:161387981-161388003 AAGTAAAAAAAAATGTAGGTTGG + Intronic
1000617870 5:163449899-163449921 AATTAACCTAAAATGGATCACGG + Exonic
1000620174 5:163476154-163476176 AATTAAAAAAAAAACTAGCTGGG + Intronic
1000756782 5:165171129-165171151 AATTTAACAAAAATGGGCCGAGG - Intergenic
1000787871 5:165569002-165569024 AATTAAACAAGAATGATGCACGG - Intergenic
1000837314 5:166171814-166171836 ATTTAAAAAAAAAAGGAGCTAGG - Intergenic
1000881030 5:166697794-166697816 AATTAAAAAAAAAATTAGCTGGG - Intergenic
1001368932 5:171176294-171176316 AAAGAAAGACAAATGGAGCTGGG - Intronic
1001404590 5:171467011-171467033 AAATAAACAGAAAAGGAACTGGG + Intergenic
1001608344 5:172980270-172980292 ATTTAAACAAAAAATTAGCTGGG - Intergenic
1001655708 5:173347885-173347907 AATTAAAAAAAAAAATAGCTGGG + Intergenic
1001924422 5:175626017-175626039 AATTAAAAAAAAAATTAGCTGGG - Intergenic
1002544528 5:179930879-179930901 AATTACAAAAAAAAGTAGCTGGG + Intronic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1002651928 5:180704177-180704199 AATTATACAGAAAAGTAGCTGGG - Intergenic
1002920530 6:1567175-1567197 AATTATAAAAAAATTTAGCTGGG - Intergenic
1003538186 6:6994555-6994577 AATTAGAAAAAAATAGAGATGGG + Intergenic
1003900888 6:10654439-10654461 AATAAAATAAAAATAGAGATGGG + Intergenic
1004683851 6:17922793-17922815 AATTAAAAAAAAATAGAGATGGG + Intronic
1004777789 6:18868051-18868073 AAAAATACAAAAAAGGAGCTGGG + Intergenic
1004891629 6:20106581-20106603 AATTATACAAAAAAGTAGCTGGG - Intronic
1004942524 6:20575100-20575122 AATTAAAAAAAAATAAAGTTAGG + Intronic
1005253906 6:23979223-23979245 TTTTAAACAAAAATGGGACTAGG + Intergenic
1005291543 6:24384312-24384334 AATTAAAAAAAAGTGCATCTGGG - Intergenic
1005596768 6:27386744-27386766 AATTAACCCAAAATGGATCAAGG + Intronic
1005679564 6:28192712-28192734 AATTAACAAAAAATGGATCATGG + Intergenic
1005961009 6:30693162-30693184 AAAAAAAAAAAAAAGGAGCTGGG + Intergenic
1006027015 6:31153571-31153593 AATAAAATAAAAAAGGAACTGGG - Intronic
1006107523 6:31725322-31725344 AAAAAAAAAAAAAAGGAGCTAGG - Intronic
1006721975 6:36161151-36161173 AATGAAACAAAAATTAAGGTAGG - Intergenic
1007328058 6:41078411-41078433 ATATAAACAAAAATGTAGATAGG - Intronic
1008225776 6:48914210-48914232 AAATAAACAAAATTGGAGAATGG - Intergenic
1008263415 6:49394615-49394637 AAATACAAAAAAATGTAGCTGGG - Intergenic
1008267573 6:49448702-49448724 AAATAATGAAAAATGGAACTTGG - Intronic
1008371876 6:50741696-50741718 AATTAAAAAAAAAAGGTGCATGG + Intronic
1008550187 6:52621405-52621427 AATTAAAAAAAAAAATAGCTTGG + Intergenic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1009006148 6:57790343-57790365 CATTAAGCAAAAATGCAACTCGG - Intergenic
1009038965 6:58154698-58154720 AAAGAAAAAAAAATTGAGCTGGG - Intergenic
1009057349 6:58352986-58353008 AATAAAGAAAAAATGGAGCAAGG + Intergenic
1009214861 6:60909534-60909556 AAAGAAAAAAAAATTGAGCTGGG - Intergenic
1009351181 6:62680771-62680793 AAAAAAAAAAAAATTGAGCTGGG + Intergenic
1009594055 6:65711528-65711550 GTACAAACAAAAATGGAGCTGGG - Intergenic
1010026089 6:71218965-71218987 AAATAAACAAAAAAGTAGCTAGG + Intergenic
1010232726 6:73549601-73549623 AATTTAAAAAAAATAGAGATGGG + Intergenic
1010576883 6:77542631-77542653 AATTAAATAAAAATGGATCATGG + Intergenic
1010646296 6:78391585-78391607 AATTTAACAAAAATACAGATGGG + Intergenic
1010697765 6:78998475-78998497 AATTAAACATAAATGTTGCTTGG + Intronic
1010889753 6:81292211-81292233 GAATAAATAAAAATGGACCTGGG - Intergenic
1010975233 6:82304822-82304844 AATTAAAAAAAAAAAGAGCCTGG - Intergenic
1011044010 6:83062029-83062051 AATTAAACAAAAAAGGAATGGGG - Intronic
1011430098 6:87276406-87276428 AAAGAAAAAAAAATGTAGCTAGG - Intergenic
1011504943 6:88031092-88031114 AATTAAAAAAAAACTGAGGTAGG + Intergenic
1011538291 6:88402136-88402158 AATTAAAAAATAAAGGAGCCAGG - Intergenic
1011608920 6:89131514-89131536 AATTAAAAAAAAATAGAGACAGG - Intergenic
1011749930 6:90445155-90445177 AATTAAACAAGAAAGGAGGTAGG + Intergenic
1011772948 6:90695130-90695152 AATTAAAAAAAAATAGAGATGGG + Intergenic
1011795891 6:90950874-90950896 AATTATTTAAAAATGGAACTGGG + Intergenic
1012068437 6:94579265-94579287 AAATAAACAAACATGAGGCTGGG - Intergenic
1012147387 6:95702612-95702634 AATAAAACAAAAATGTGGATTGG + Intergenic
1012153470 6:95785755-95785777 AATTAAATCATAATGGAGCAAGG - Intergenic
1012178021 6:96113558-96113580 AATTTAACAGAAATCGGGCTGGG + Intronic
1012733742 6:102913005-102913027 GATTAGAAAAAAATGCAGCTTGG + Intergenic
1012744996 6:103075114-103075136 AATTAAAAAAAAATAGATTTTGG - Intergenic
1012989937 6:105915291-105915313 AACTAAACAAAAAATTAGCTGGG - Intergenic
1013066902 6:106692903-106692925 AATTAAAAACAAATAGAGGTGGG - Intergenic
1013120477 6:107136360-107136382 AAACAAATAAAAATTGAGCTGGG - Intergenic
1013222912 6:108095449-108095471 AATTAAAAAAAAAATTAGCTGGG + Intronic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013937018 6:115608992-115609014 AATGAAAGAAAAAAGGAGCAAGG + Intergenic
1013969631 6:116001249-116001271 AAGAAAAGAAAAATGGAGCTTGG + Intronic
1013990071 6:116243365-116243387 AATTAAACTCACATAGAGCTCGG + Intronic
1014929818 6:127322008-127322030 AAACAAACAAAAAAGTAGCTAGG + Intronic
1015213756 6:130726263-130726285 AATTAAACACAACTGGATATAGG - Intergenic
1015284480 6:131469664-131469686 AATAAAACACAAATGGAACTTGG - Intergenic
1015351225 6:132222317-132222339 GATTAAAAAAAAACGGAGTTAGG + Intergenic
1015651535 6:135467075-135467097 AAGTCAACACAAATGGAGGTGGG - Intronic
1015980548 6:138833820-138833842 AATTAAAAAAAAATGCACCAGGG + Intronic
1016084543 6:139896321-139896343 AATTAAATAAAAACTTAGCTAGG - Intergenic
1016159587 6:140861885-140861907 AATTAAAAAAAAATGGGGATGGG - Intergenic
1016620521 6:146104097-146104119 AAGTAATGAAAAATTGAGCTAGG + Intronic
1017915583 6:158829244-158829266 AATTAAAAAAAAATTTAGCTGGG + Intergenic
1018002723 6:159594011-159594033 AATTATTCAAATATGGAACTAGG - Intergenic
1018023346 6:159783992-159784014 CAAAAAACAAAAATGAAGCTTGG - Exonic
1019131302 6:169878887-169878909 AATTAAAACAAAATAAAGCTGGG - Intergenic
1019969538 7:4529124-4529146 AACAAAAAAAAAATGGAGTTGGG + Intergenic
1019987432 7:4667976-4667998 TAAAAAACAAAAATGAAGCTCGG + Intergenic
1020117813 7:5486091-5486113 AAATAAATAAAAATTTAGCTGGG + Intronic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020320098 7:6933591-6933613 TTTAAAACAAAAATGGGGCTGGG + Intergenic
1020369160 7:7414024-7414046 ACTTAAACAAGGATGGAGATGGG + Intronic
1020453985 7:8351120-8351142 ACTTAAAGAAGAATGGGGCTGGG + Intergenic
1020481171 7:8663404-8663426 AATTAATCTACAATGGGGCTAGG - Intronic
1020664954 7:11029165-11029187 ATTTAAAGAAAAATAGAGCAAGG - Intronic
1020735329 7:11941941-11941963 AATGAAAGAAAAATGGAGGGAGG - Intergenic
1021727633 7:23564868-23564890 AATAAAACAAAAAATTAGCTGGG - Intergenic
1021816191 7:24449686-24449708 AATACAAAAAAAATGTAGCTGGG - Intergenic
1022157067 7:27671297-27671319 AATTAAAAATAAATTCAGCTGGG - Intergenic
1022160869 7:27709882-27709904 AATGAAACAGAAATGCAACTTGG - Intergenic
1023334098 7:39150453-39150475 AAAAAAAAAAAAATGTAGCTTGG - Intronic
1023403228 7:39805915-39805937 TTTAAAACAAAAATGGGGCTGGG - Intergenic
1023691676 7:42795628-42795650 CAAAAAACAAAAATGAAGCTTGG + Intergenic
1023819244 7:43971212-43971234 AAAAAAAAAAAAATGGAGATGGG - Intergenic
1024665134 7:51538612-51538634 AATAAAAAAAAAATAGAGGTTGG - Intergenic
1024818933 7:53304292-53304314 AATTATACAAAATTGGGACTTGG - Intergenic
1025772592 7:64527398-64527420 AATTAATAAAAAAAGGTGCTGGG + Intronic
1025953209 7:66162405-66162427 AATTAAATAAAAATGGTTCAAGG + Intergenic
1025966586 7:66278621-66278643 AAATATACAAAAAAGTAGCTGGG + Intronic
1026019508 7:66696706-66696728 AAAAAAAGAAAAATGGAGCGTGG + Intronic
1026034874 7:66823837-66823859 AATTAATCAAAAAATTAGCTGGG + Intergenic
1026125891 7:67579181-67579203 AAAAATACAAAAATTGAGCTGGG + Intergenic
1026150612 7:67785217-67785239 AATTTTAAAAAAATGGAGATGGG + Intergenic
1026542856 7:71295764-71295786 AATTAAAAAAAATTAGAGATGGG + Intronic
1026602747 7:71789940-71789962 AATAAAAAAAAAATTTAGCTGGG + Intronic
1026650360 7:72210893-72210915 AATTAAAAAAAAAATTAGCTGGG + Intronic
1026670297 7:72384476-72384498 AATTAATTCAAAATGGGGCTTGG + Intronic
1026835562 7:73636763-73636785 AATTAAAAAAAAATTTAGGTTGG + Intergenic
1026990025 7:74579785-74579807 ATTTAAAAAAAAATGTAGCCTGG - Intronic
1027473318 7:78599234-78599256 AAGTATACAAAAATGGAACTGGG - Intronic
1027475616 7:78627746-78627768 AATCAAATAAAAATGGCTCTGGG - Intronic
1027981070 7:85223139-85223161 AATTAAAAAAAAATAGATGTTGG + Intergenic
1028165739 7:87536847-87536869 AATAAAAGAAAAATTGAGCAGGG + Intronic
1028174635 7:87640502-87640524 AATTAAAAAAAAAATTAGCTGGG - Intronic
1028474679 7:91240254-91240276 AATAAAATAAAAAATGAGCTGGG - Intergenic
1028750553 7:94377716-94377738 AAATAAAGAGAAATGGAGTTTGG - Intergenic
1028760904 7:94495396-94495418 CATTAAAAAAAAATAGAGCAAGG + Intergenic
1028976046 7:96915417-96915439 AAGTAAATAAAAATAAAGCTCGG + Intergenic
1029177183 7:98673155-98673177 AAAAAAAAAAAAAAGGAGCTAGG - Intergenic
1029368196 7:100129915-100129937 AAAAAAAAAAAAATGTAGCTGGG - Intergenic
1029429011 7:100517282-100517304 AATTAAAAAAAAATTTAGCCAGG - Intergenic
1029433759 7:100549660-100549682 AAATAAACAAATATTGAGCATGG - Intronic
1029469278 7:100743886-100743908 AAATAAATAAAAATAGAGATGGG + Intronic
1029572613 7:101380283-101380305 AAAAAAAAAAAAATGTAGCTGGG - Intronic
1029744296 7:102508175-102508197 AAAAAAAAAAAAATGGAGATGGG - Intronic
1029762287 7:102607337-102607359 AAAAAAAAAAAAATGGAGATGGG - Intronic
1029926523 7:104325221-104325243 AGTTAGACAAAGATGGTGCTAGG + Intergenic
1029998402 7:105032146-105032168 AGTTAAAGATAAATGGGGCTGGG + Intronic
1030414528 7:109225584-109225606 AATTAAATCAAAATGGATCATGG - Intergenic
1030460495 7:109828710-109828732 AATTAAAAAAAAAAATAGCTGGG + Intergenic
1030480741 7:110100822-110100844 AAATAAAAAAAAATAGAGGTTGG + Intergenic
1031056929 7:117002065-117002087 AAATACAAAAAAATGTAGCTGGG + Intronic
1031587065 7:123544201-123544223 AAATAAAAAAAATTTGAGCTGGG + Intronic
1031838452 7:126707130-126707152 ATTTAAAAAAAAATAGAGATAGG - Intronic
1031855267 7:126914952-126914974 AATTAAAAAGAAAAGGACCTTGG + Intronic
1031952106 7:127903175-127903197 AAATAAAAAAAAATCGGGCTGGG - Intronic
1032030083 7:128476145-128476167 AATTAAAAAAAAATTGTCCTTGG + Intergenic
1032226161 7:130033310-130033332 AATTAAACTAAAATGCAGCCAGG - Intronic
1032350354 7:131157235-131157257 AATAAAATAAAAATGTAGCTGGG + Intronic
1032771719 7:135065891-135065913 AAAGAAACAAAAATGGTGTTGGG + Intronic
1033020334 7:137718325-137718347 AAGTAAATAACAATGGGGCTGGG + Intronic
1033126062 7:138708339-138708361 AATAAAACATAAATGAGGCTGGG - Intronic
1033611628 7:142968765-142968787 AAGTAAACAAAAATTTAGCCGGG - Intergenic
1033640658 7:143260857-143260879 AGAAAAACAAAAATGTAGCTGGG + Intronic
1033642438 7:143274606-143274628 AATTAAAATAAAATAGAGATGGG - Intergenic
1033919272 7:146368716-146368738 AAATAAACAAAACTGGGGATAGG - Intronic
1034148231 7:148891276-148891298 AATTAAAGAAGAATGAAACTGGG + Intergenic
1034199001 7:149269652-149269674 AATTTAAAAAAAATGTTGCTAGG - Intronic
1034507203 7:151502234-151502256 AAAAAAAAAAAAAAGGAGCTTGG + Intronic
1034628240 7:152510624-152510646 AAATAAACAGAAATAGAGATGGG + Intergenic
1034710138 7:153184003-153184025 AAATATACAAAAAAGTAGCTGGG + Intergenic
1034727304 7:153349198-153349220 AATTAAACAAAAAGGTGGCAAGG - Intergenic
1034926746 7:155128932-155128954 AATAAAATAAACATGAAGCTGGG + Intergenic
1035004813 7:155648207-155648229 AAATATACAAAAGTGGAGGTGGG - Intronic
1035415218 7:158677969-158677991 AATTAAAAAAAAAATCAGCTGGG - Intronic
1036060139 8:5308053-5308075 AATGAAACAAAACTGGAACAAGG + Intergenic
1036247434 8:7130616-7130638 AAATAAACAAAAATAGGGCCGGG + Intergenic
1036552010 8:9824270-9824292 AATTAAACAAAAGCCGGGCTTGG + Intergenic
1037282068 8:17252471-17252493 AAATAAAGAAAAATTGGGCTGGG - Intronic
1037548708 8:19948932-19948954 AATTAAAAAAAAAAAGGGCTGGG + Intronic
1038248989 8:25885201-25885223 AGTTAAAAAAAAAAGGAGCCTGG - Intronic
1038394584 8:27237424-27237446 ATTTAAACAAAAATAGAGATGGG + Intronic
1038769080 8:30459413-30459435 AATTAAAATAGAATGAAGCTGGG - Intronic
1038786943 8:30626189-30626211 AATAAAAGTAAAATGTAGCTGGG + Intronic
1038791667 8:30673437-30673459 TCTTAAAAAAAAATGTAGCTAGG + Intergenic
1039140380 8:34380934-34380956 TATTAAAAAAAAATGGAGCCAGG + Intergenic
1039256398 8:35723554-35723576 AATAAAACAAAAACTTAGCTTGG - Intronic
1039522059 8:38179470-38179492 AATTAAAGAAAGATCCAGCTGGG + Intronic
1039535614 8:38309487-38309509 AATTAAATAAAAAGCTAGCTGGG + Intronic
1039778299 8:40758695-40758717 AAGCAAAGAAAAATGGATCTTGG + Intronic
1039848689 8:41343961-41343983 AAATTAAAAAAAATTGAGCTGGG - Intergenic
1039874858 8:41577112-41577134 AATTAAAAAAAAATGGTGGGGGG - Intergenic
1040048769 8:42990901-42990923 AATAAAACAAAACTGGACATTGG - Intronic
1040625836 8:49149211-49149233 AATTATAGGAAAATGGTGCTGGG + Intergenic
1040777548 8:51064504-51064526 AATTCATCAAAAATGGTTCTTGG - Intergenic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1041458197 8:58082822-58082844 AAAAAAACAAAAATGGAGATGGG - Intronic
1041546447 8:59048663-59048685 AATTAATTAAAAATGTATCTGGG - Intronic
1041857236 8:62471784-62471806 AATTAAAGAAAAAGATAGCTGGG + Intronic
1041965309 8:63668873-63668895 AAATAAAAAAAAATTGAACTAGG - Intergenic
1042627495 8:70774436-70774458 AATAAAACACAAATGAAGCGAGG - Intronic
1042847559 8:73184081-73184103 AATTAAAAAAAAAGTTAGCTGGG - Intergenic
1042867150 8:73366092-73366114 AGTTAAAAAAAAATAGTGCTGGG + Intergenic
1043823117 8:84892752-84892774 AACTAAACAAAAAACAAGCTCGG + Intronic
1043936276 8:86146398-86146420 CATTAAAAAAAAATCCAGCTAGG + Intronic
1043953851 8:86339530-86339552 AATTAAAAAAAAAATTAGCTAGG + Intergenic
1044242009 8:89899483-89899505 AATTAAAAGAAAATTTAGCTAGG + Intergenic
1044789913 8:95836737-95836759 AATTAACAAGAAATGGAGCTAGG + Intergenic
1045259773 8:100562171-100562193 AGCTAAACAGAAATGCAGCTGGG - Intergenic
1045465850 8:102469052-102469074 AATTAAAAAAATATTTAGCTGGG + Intergenic
1045483480 8:102611622-102611644 AATTAAATAGAAAAGGTGCTGGG - Intergenic
1045833614 8:106493782-106493804 ATTGAAAGAAAAATGGAGCTGGG + Intronic
1045881462 8:107045761-107045783 AATTTAAAAAAAATGGGGATGGG + Intergenic
1047385879 8:124408743-124408765 AATTAAAAAAAAAAATAGCTGGG - Intergenic
1047671138 8:127148759-127148781 AATTAAAAAAAAAAAAAGCTAGG + Intergenic
1048014928 8:130488842-130488864 AATTAAAAAAAAAATTAGCTGGG + Intergenic
1048247308 8:132820939-132820961 AATAAAAAAAAAATGAAGATGGG - Intronic
1048423615 8:134302127-134302149 AAATAAAGAAAAATCGAGCCTGG - Intergenic
1048449430 8:134520446-134520468 AAAAAAACAAAAAAGCAGCTAGG + Intronic
1048701230 8:137092032-137092054 AATTAAATAAAAATGCAAATTGG - Intergenic
1048806900 8:138249543-138249565 AATGAAAGAATAATGGAGCCAGG + Intronic
1050341518 9:4644207-4644229 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1050785393 9:9394798-9394820 TTTTAATCAAAAATGGAGCTTGG - Intronic
1051324646 9:15952012-15952034 AATTAAATCAAAATGGATCAAGG - Intronic
1051657400 9:19396251-19396273 AAAAAAAAAAAAATGCAGCTTGG - Intergenic
1052111176 9:24584075-24584097 AATTAAAAAAAAAATGAGGTAGG - Intergenic
1052792810 9:32891850-32891872 AATTATACATACATGAAGCTTGG - Intergenic
1053085636 9:35218524-35218546 TAATAAATAAAAATGGAGCCTGG - Intronic
1053127101 9:35590973-35590995 AAGTGAACAAAAAAGGAGTTTGG + Intergenic
1053449877 9:38184414-38184436 AATTACACAAAAATGATGCTGGG + Intergenic
1054853031 9:69868373-69868395 AAAGAAACAAAAATGAGGCTGGG + Intronic
1054856124 9:69901296-69901318 AAATATACAAAAATTTAGCTGGG - Intronic
1055520507 9:77076218-77076240 AATTAAAAAAAAAAGGAGAGAGG - Intergenic
1055547975 9:77401241-77401263 AATTATACTAAAATGTAGCTAGG - Intronic
1055662878 9:78523792-78523814 AATTAAACAAAAATTTAGCCAGG + Intergenic
1056071675 9:82993561-82993583 AATGAAACAAAAAGGGAGTTTGG + Intronic
1056079646 9:83078369-83078391 TATTAAACAGAAATGAGGCTGGG + Intergenic
1056175160 9:84027530-84027552 AAATAAATAAAAATTTAGCTGGG + Intergenic
1056376016 9:86011653-86011675 AATTAAATAAAAATGAAGCCGGG - Intronic
1056528090 9:87462662-87462684 AAATAAACAAAAAATTAGCTGGG - Intergenic
1056674520 9:88663302-88663324 AATTAACTTAAAATGGATCTTGG + Intergenic
1056685582 9:88756372-88756394 AATTAAAAAAAAAAATAGCTGGG - Intergenic
1056988407 9:91386906-91386928 AATCAAACAAAAACAAAGCTTGG - Intergenic
1057065434 9:92045338-92045360 AAAAAAAAAAAAATGGAGGTTGG - Intronic
1057482658 9:95457695-95457717 AATTAAAGAAAAAATGAGCTAGG + Intronic
1057673491 9:97117664-97117686 AATTAAAAAAAAAAAGAGTTGGG + Intergenic
1057842982 9:98501145-98501167 AATTAAAAAAAAAAGGAGCAGGG - Intronic
1058389017 9:104473225-104473247 AAATACAAAAAAATGTAGCTGGG - Intergenic
1058473181 9:105302499-105302521 AATTAACCAAGAGTGGTGCTGGG - Intronic
1059252510 9:112898607-112898629 ACTGAAAAAAAAATAGAGCTTGG + Intergenic
1059275660 9:113094780-113094802 AATTAAACAAGGATGGTGCAGGG + Intergenic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1059783888 9:117559432-117559454 AAATTAAGAAAAATGCAGCTGGG + Intergenic
1059845143 9:118267337-118267359 AAACAAACAAAAATCTAGCTGGG - Intergenic
1060128253 9:121071387-121071409 AATTAAAAAAAAATCAGGCTGGG + Intergenic
1060173089 9:121477734-121477756 AATTAAAAAAAAAATTAGCTGGG - Intergenic
1060322951 9:122582557-122582579 AATTAAAAAAAAAATTAGCTGGG + Intergenic
1060774392 9:126361091-126361113 AATTAAACAAAAAGCAAGATTGG - Intronic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1061142726 9:128778221-128778243 AAATATACAAAAAAGTAGCTGGG + Intergenic
1061142860 9:128779165-128779187 AAATACAAAAAAATGGGGCTGGG + Intergenic
1061620980 9:131811142-131811164 AACAAAACAAAAAAGGAGGTGGG + Intergenic
1061626746 9:131844948-131844970 AATAAAACAAATATGGAGTTTGG + Intergenic
1062065196 9:134522947-134522969 AATAAAAAAAAAATGGGGCCGGG - Intergenic
1062632572 9:137471914-137471936 AATTAAAGAAAAATGGAAAATGG + Intronic
1186092911 X:6068992-6069014 AATTAAATAAAAGTGGGGCCGGG + Intronic
1186571649 X:10721214-10721236 AAATAAAGAAAAATGAAGTTGGG + Intronic
1186960194 X:14728230-14728252 AGTTAAACAAAAAATTAGCTGGG + Intronic
1187331361 X:18343162-18343184 AATAAAAAAAAAAGGGAGGTGGG - Intronic
1187501967 X:19846210-19846232 ACTTAAAAAAAAATTTAGCTGGG - Intronic
1187515199 X:19963172-19963194 AAAAAAAAAAAAAGGGAGCTTGG - Intronic
1187517251 X:19983552-19983574 AATATAAAAAAAATGTAGCTGGG + Intergenic
1187517305 X:19983909-19983931 AAATATAAAAAAATGTAGCTGGG + Intergenic
1187563274 X:20422740-20422762 AATTAAAAAAAAAATTAGCTGGG + Intergenic
1187987804 X:24833553-24833575 AATTAAAAAAAAATAGATGTTGG - Intronic
1188058500 X:25570520-25570542 AATTATACACAAATAAAGCTGGG - Intergenic
1188198658 X:27272078-27272100 ATTTAATCAATAATGGAGCCGGG + Intergenic
1188479297 X:30620945-30620967 AAATAAAAAAAAATGTAGCTGGG + Intergenic
1188597972 X:31924291-31924313 AATTAAATAAAGCTAGAGCTTGG - Intronic
1188832192 X:34912545-34912567 AATAAAACAAAAATAGATGTTGG + Intergenic
1189304443 X:39976012-39976034 AACAAAACAAAAATATAGCTGGG - Intergenic
1189360499 X:40346825-40346847 AATTAAAAAAAAATAGATGTTGG + Intergenic
1189595192 X:42557198-42557220 AAATAACCAAAATTGCAGCTGGG + Intergenic
1189766961 X:44381732-44381754 AATTAAAAAAAAATTAGGCTGGG - Intergenic
1189867219 X:45343449-45343471 AATGAAAAAGAAATGGAACTTGG + Intergenic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190200402 X:48356014-48356036 AAATAAACAAAAAGTTAGCTGGG + Intronic
1190258257 X:48780984-48781006 AAATTAACAAAAATTTAGCTGGG + Intergenic
1190523554 X:51304991-51305013 AATTAAAAAAAATTCCAGCTGGG + Intergenic
1190589045 X:51978689-51978711 AATTAAAGAAAAAATTAGCTGGG + Intergenic
1190715431 X:53099018-53099040 AATTAAAAAAAAAAATAGCTGGG - Intergenic
1190845580 X:54187567-54187589 AACAAAACAAAAAGTGAGCTGGG + Intergenic
1191115868 X:56852047-56852069 AAATAAAAATAAATGGTGCTGGG + Intergenic
1191636346 X:63381677-63381699 AATAAAACAAAAAAATAGCTGGG + Intergenic
1191916418 X:66206521-66206543 AATTAAAAAAAAAATCAGCTGGG - Intronic
1192556844 X:72096989-72097011 AATTATACAAAATTACAGCTGGG - Intergenic
1192568955 X:72186656-72186678 AATAACACAAAATTGTAGCTGGG + Intronic
1192814782 X:74578985-74579007 ACTTATACTAAAATGAAGCTTGG + Intergenic
1193247099 X:79242180-79242202 AAATAAACACAAATGCAGGTGGG - Intergenic
1193281809 X:79659863-79659885 AATTAAAAAAAAATAGATGTTGG - Intergenic
1193313870 X:80041779-80041801 AATTAAAAAAAAATAGATGTTGG - Intergenic
1193355116 X:80510847-80510869 AATTAACCTAAAATGGATCATGG + Intergenic
1194763890 X:97826802-97826824 AGTTAAATTAAAATGGAGTTTGG - Intergenic
1195265642 X:103176759-103176781 ATATAAACAAAAATGGATCCAGG + Intergenic
1195641377 X:107178932-107178954 AAATAAAAAAAAAATGAGCTGGG + Intronic
1195693882 X:107652365-107652387 AAATAAACAAAAGTAGACCTGGG - Intergenic
1195951870 X:110283824-110283846 AATTAAAATAAAATGAGGCTGGG + Intronic
1196439605 X:115706413-115706435 AAGGAAAGAAAATTGGAGCTAGG - Intergenic
1196678462 X:118445528-118445550 AATTAAACCCAAATGAAGCAGGG + Intronic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1197068125 X:122258905-122258927 AAAAAAACAAAAAAGTAGCTGGG - Intergenic
1197128052 X:122971127-122971149 AATTTAAAAGAAATGGAGATGGG + Intergenic
1197252125 X:124227364-124227386 AATTATACAAAAAAATAGCTGGG - Intronic
1197773055 X:130101983-130102005 ATTTAAAAAAAAATTTAGCTGGG + Intronic
1197928606 X:131672783-131672805 GGTTAAAAAAAAATGTAGCTGGG + Intergenic
1198252850 X:134898027-134898049 AATTAAAAAAAAAAATAGCTGGG - Intronic
1198303788 X:135359434-135359456 ATTTAAACGAAAATTGAACTGGG - Intronic
1198380893 X:136082386-136082408 AATTATGCAAAAATAGAGATGGG + Intergenic
1198461160 X:136864226-136864248 AATTTAACAAAAATGGTTCTTGG - Intronic
1199171631 X:144740342-144740364 TATTAAACATAAACTGAGCTTGG - Intergenic
1199253524 X:145692606-145692628 AACCAGATAAAAATGGAGCTGGG + Intergenic
1201255067 Y:12099321-12099343 AATTAAAGAAAAGTTTAGCTGGG + Intergenic
1201767710 Y:17588061-17588083 AAAAAAAAAAAAATGAAGCTGGG + Intergenic
1201833843 Y:18317924-18317946 AAAAAAAAAAAAATGAAGCTGGG - Intergenic
1201889227 Y:18923350-18923372 AAACACACAAAAATAGAGCTGGG - Intergenic