ID: 996195765

View in Genome Browser
Species Human (GRCh38)
Location 5:120605210-120605232
Sequence GATAATCCTGTATTTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8031
Summary {0: 1, 1: 3, 2: 63, 3: 615, 4: 7349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996195763_996195765 5 Left 996195763 5:120605182-120605204 CCAATGAGTTATAGGTGTGGTCT 0: 1
1: 4
2: 45
3: 264
4: 801
Right 996195765 5:120605210-120605232 GATAATCCTGTATTTCTTGGAGG 0: 1
1: 3
2: 63
3: 615
4: 7349
996195759_996195765 23 Left 996195759 5:120605164-120605186 CCATCTCTTTCAGGAATCCCAAT 0: 1
1: 17
2: 205
3: 764
4: 5257
Right 996195765 5:120605210-120605232 GATAATCCTGTATTTCTTGGAGG 0: 1
1: 3
2: 63
3: 615
4: 7349
996195762_996195765 6 Left 996195762 5:120605181-120605203 CCCAATGAGTTATAGGTGTGGTC 0: 1
1: 0
2: 5
3: 50
4: 169
Right 996195765 5:120605210-120605232 GATAATCCTGTATTTCTTGGAGG 0: 1
1: 3
2: 63
3: 615
4: 7349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996195765 Original CRISPR GATAATCCTGTATTTCTTGG AGG Intronic
Too many off-targets to display for this crispr