ID: 996196402

View in Genome Browser
Species Human (GRCh38)
Location 5:120611952-120611974
Sequence CTCCGCCCCCATGGCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2004
Summary {0: 1, 1: 0, 2: 24, 3: 244, 4: 1735}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996196402_996196404 -7 Left 996196402 5:120611952-120611974 CCTGCACAGCCATGGGGGCGGAG 0: 1
1: 0
2: 24
3: 244
4: 1735
Right 996196404 5:120611968-120611990 GGCGGAGCTGCCCAAGACCATGG 0: 64
1: 672
2: 1191
3: 1272
4: 1548
996196402_996196405 -6 Left 996196402 5:120611952-120611974 CCTGCACAGCCATGGGGGCGGAG 0: 1
1: 0
2: 24
3: 244
4: 1735
Right 996196405 5:120611969-120611991 GCGGAGCTGCCCAAGACCATGGG 0: 69
1: 729
2: 1201
3: 1346
4: 1417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996196402 Original CRISPR CTCCGCCCCCATGGCTGTGC AGG (reversed) Intronic
Too many off-targets to display for this crispr