ID: 996201957

View in Genome Browser
Species Human (GRCh38)
Location 5:120686372-120686394
Sequence AAGACAGATGTCCCCAGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996201953_996201957 3 Left 996201953 5:120686346-120686368 CCAGCTTCTGATGCATAGACCTG 0: 1
1: 0
2: 2
3: 5
4: 122
Right 996201957 5:120686372-120686394 AAGACAGATGTCCCCAGGCAGGG 0: 1
1: 0
2: 5
3: 38
4: 335
996201952_996201957 8 Left 996201952 5:120686341-120686363 CCAGTCCAGCTTCTGATGCATAG 0: 1
1: 0
2: 2
3: 6
4: 115
Right 996201957 5:120686372-120686394 AAGACAGATGTCCCCAGGCAGGG 0: 1
1: 0
2: 5
3: 38
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996201957 Original CRISPR AAGACAGATGTCCCCAGGCA GGG Exonic
900546212 1:3230693-3230715 AGGACAGCTGTCCCCAGGATTGG + Intronic
900586088 1:3433011-3433033 AAAACAGACATCCCCTGGCAGGG + Intronic
901152882 1:7115789-7115811 AAGACTCACGTCCCCATGCAAGG + Intronic
901420876 1:9150353-9150375 AAGAAAGATGGGCCCAGGCAGGG + Intergenic
901512494 1:9724475-9724497 AGGGCAGAGGTTCCCAGGCAGGG + Intronic
901572117 1:10169405-10169427 AAAAGAGTTGTCCCCAGGCCAGG - Intronic
903161324 1:21491197-21491219 AACACAGTGGTGCCCAGGCAGGG - Intergenic
903755612 1:25658395-25658417 AAGGCAGGTGGCCCCAGGCTTGG + Intronic
903849927 1:26300013-26300035 AAGAAAGTTGACCCCAGCCAGGG + Intronic
903920526 1:26796903-26796925 AAAAAAGATGTCCCCAGGGTGGG - Intronic
906684935 1:47757108-47757130 AAGACACAAGTTCCCAGGCAAGG - Intergenic
907008289 1:50938265-50938287 AAGACAGACGTTCCCTGGCCAGG + Intronic
907903483 1:58763055-58763077 AAGACACATATCCCCATGTAGGG + Intergenic
909253310 1:73385684-73385706 TAGCCAGATGTTCCAAGGCATGG + Intergenic
909731937 1:78902835-78902857 AGGACAGATGTCTCCAGTAAAGG - Intronic
911038221 1:93572065-93572087 AAGCAAGATGTCCCCGGACAGGG + Intronic
911186113 1:94906572-94906594 AAGATAGATGGAGCCAGGCATGG - Intronic
912257346 1:108073865-108073887 AAGACAGATGTCCCCAAGACAGG - Intergenic
913070207 1:115291846-115291868 ACAACACATCTCCCCAGGCATGG - Intronic
915153537 1:153855369-153855391 CAGACAGGTGTCCCCACGCCCGG + Intronic
915580219 1:156808931-156808953 AAAACAGAGGCCCCCAGGCAGGG - Intronic
915695397 1:157736191-157736213 ATAACAGATGTGGCCAGGCACGG - Intergenic
919090270 1:192970596-192970618 AATACAGAGGTCCCGAGGTAGGG + Intergenic
920461957 1:206147459-206147481 AAAACCTATTTCCCCAGGCATGG - Intergenic
921185453 1:212665890-212665912 AAGAGAGGTGACACCAGGCACGG - Intergenic
921800029 1:219392100-219392122 AAGACAGATGACCCCAAACAGGG - Intergenic
922185464 1:223270441-223270463 ATGACAGGTGTCCTCAGGGAAGG - Intronic
922609150 1:226911520-226911542 AAGGCAGACGGCCCCAGGCAGGG - Intronic
923187098 1:231584951-231584973 GAGACAGATGTCACAAAGCATGG - Intronic
923492810 1:234499305-234499327 AAGACACATTTCCCAAGGCCTGG - Intergenic
924367758 1:243313937-243313959 AAGCCAGATGGCCACAGGAATGG + Intronic
924509214 1:244714842-244714864 AAGACAGATGAGGCCAGGCGCGG + Intergenic
1063119863 10:3097712-3097734 AACACACATGTGGCCAGGCATGG + Intronic
1063406314 10:5799049-5799071 AATAAAGAGGTGCCCAGGCATGG + Intronic
1063988708 10:11536391-11536413 TAAACAGTTTTCCCCAGGCATGG - Intronic
1064037488 10:11926457-11926479 AACACAGACATCCCTAGGCAGGG + Intronic
1064443349 10:15372027-15372049 AAGTCAGACATCCCCTGGCAGGG + Intergenic
1064705544 10:18069402-18069424 AAGAGAGAGGTTCCCTGGCAAGG + Intergenic
1065313015 10:24434327-24434349 AAGAGAGATGAGGCCAGGCATGG - Intronic
1065859673 10:29861488-29861510 AAGACAGATGTAGCCAGGCACGG - Intergenic
1066186769 10:33016976-33016998 AAAACAGATGTCCCCAAAGAGGG - Intergenic
1066402906 10:35092244-35092266 AAGACAGAGGAGGCCAGGCATGG - Intergenic
1067167155 10:43874415-43874437 AAGCCAGAAGACACCAGGCAGGG + Intergenic
1069696834 10:70392699-70392721 TAGCCAGATGTGGCCAGGCATGG + Intergenic
1070080646 10:73183027-73183049 CAGAAAATTGTCCCCAGGCAGGG - Intronic
1070768690 10:79070264-79070286 TGGACAGATGTCCCCAGCGAGGG - Intronic
1070993227 10:80751369-80751391 AAGACGAATGTCGCCAGGCGCGG + Intergenic
1072477974 10:95781808-95781830 AGGACACTTGACCCCAGGCATGG + Intronic
1074572067 10:114633095-114633117 AAGACAGACATCACAAGGCAGGG + Intronic
1076122241 10:127945411-127945433 GACACAGGTGTCCACAGGCAAGG - Intronic
1076309941 10:129498191-129498213 CAGACATATGTCCCCAGGACAGG - Intronic
1076387624 10:130068453-130068475 AATACAAAAGTCGCCAGGCATGG + Intergenic
1076478388 10:130768072-130768094 AAGCCAGATGTACCCATGCCAGG + Intergenic
1078152941 11:8774690-8774712 AAGACATATGTCTCAAGGCTGGG + Intronic
1078746952 11:14125001-14125023 ATGACAGACTTCCCCATGCATGG + Intronic
1079789175 11:24713984-24714006 AAGACAGATTTGGCCAGGCATGG - Intronic
1081714359 11:45238003-45238025 AGCACAGATGGCCCCTGGCAGGG - Intergenic
1081748070 11:45487032-45487054 AAGACAGATGTCCCCATTCAAGG + Intergenic
1083225772 11:61283565-61283587 AATACAGAATTACCCAGGCATGG - Intronic
1083308443 11:61772568-61772590 CAGCCAGATGCCCCCAGGCCTGG - Intronic
1083687352 11:64384573-64384595 AAGACAGCAGTCACCAGGCCAGG + Intergenic
1084652433 11:70496955-70496977 AGACCAGATGTCCACAGGCAAGG - Intronic
1085637762 11:78171615-78171637 AAGACAGCTGTCCCAGGCCAAGG - Exonic
1086449085 11:86898617-86898639 AAGACATATGTCCCAAGGACAGG - Intronic
1090017500 11:123099120-123099142 AACACAGTTGTTTCCAGGCACGG - Intronic
1091278506 11:134368760-134368782 AAGTCAGATGTCACCAGCTATGG + Exonic
1091785058 12:3238355-3238377 AGGACACATGTCCCCAGGGTGGG - Intronic
1091968296 12:4764070-4764092 ACGACAGACTTGCCCAGGCAGGG - Intronic
1094846074 12:34361946-34361968 GAGACAGAGGTCCCCTGCCACGG - Intergenic
1094855320 12:34400325-34400347 AAGGCAGAGGTCCCCACCCATGG + Intergenic
1095195846 12:39316004-39316026 AATACAGATGTCAACAGGTAAGG + Intronic
1098251350 12:68572912-68572934 AAGACAAATGTCACCAGTTAAGG + Intergenic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1099339615 12:81411642-81411664 AAAACAGTTGTTCACAGGCAAGG - Intronic
1100835576 12:98563919-98563941 CAGACACATGTCACCAGGCCTGG - Intergenic
1101840936 12:108327180-108327202 AAGAAAGATGTCCTGAGGCCAGG + Intronic
1102880907 12:116484104-116484126 AAGATAAATGTACCCAGGCACGG - Intergenic
1102888050 12:116536379-116536401 AGGATAAATGACCCCAGGCAAGG - Intergenic
1103676582 12:122660737-122660759 TACACAGAGGTCTCCAGGCATGG - Intergenic
1103939161 12:124492625-124492647 AAGACAGATCCCCCCGGGTAAGG - Intronic
1104110520 12:125700193-125700215 TAGACAGAGGTCCCCAGGTGTGG - Intergenic
1104705254 12:130940533-130940555 AAGACAGAGGATCCCAGGCAGGG + Intergenic
1108142010 13:47433481-47433503 GAGACTGATGTCCACAGACATGG - Intergenic
1108678068 13:52755380-52755402 AAGAAACATGGCCCCAGGCCGGG + Intergenic
1108845137 13:54669289-54669311 AAGACAGGAGTCCCCAGCCCTGG + Intergenic
1109024478 13:57141226-57141248 AAGACAGAGGTGACAAGGCAGGG - Intronic
1109025465 13:57147796-57147818 AAGACAGAGGTGACAAGGCAGGG - Intronic
1109026455 13:57154369-57154391 AAGACAGAGGTGACAAGGCAGGG - Intronic
1109027447 13:57160940-57160962 AAGACAGAGGTGACAAGGCAGGG - Intronic
1109028433 13:57167505-57167527 AAGACAGAGGTGACAAGGCAGGG - Intronic
1109186253 13:59272138-59272160 GAGACAGATGTGCCCAGAGAGGG + Intergenic
1111384592 13:87507935-87507957 AATACAGATTTCCACAGGCGTGG - Intergenic
1112029231 13:95441859-95441881 AAGACACATATGGCCAGGCATGG + Intronic
1112195728 13:97224323-97224345 AGCACAGATGGCCCCAAGCAGGG + Intronic
1112229460 13:97573408-97573430 AAGATAGAAGTCCCCAGGGTTGG - Intergenic
1112286649 13:98110884-98110906 AAGACAGCTGTCTCCAAGCCAGG - Intergenic
1112554114 13:100451102-100451124 AAGACAGACCTCCCCAAGCAAGG - Intronic
1113398397 13:109969759-109969781 AAGACATATGGGGCCAGGCACGG - Intergenic
1113976086 13:114228616-114228638 AAGACTGCTGTCCACAGACACGG - Intergenic
1114632120 14:24165786-24165808 AAGAGAGAGGGCCACAGGCAGGG - Intronic
1117308124 14:54496246-54496268 AAGACAGAGGTGACCGGGCATGG - Intergenic
1117745948 14:58869688-58869710 AAGGAAGAGGACCCCAGGCAGGG - Intergenic
1119732015 14:76957038-76957060 AACACAGATGCCCACAGACAGGG - Intergenic
1119771433 14:77222487-77222509 AGAATATATGTCCCCAGGCAGGG - Intronic
1120215208 14:81674697-81674719 AATACAGATGTCCCCACTCAGGG - Intergenic
1120990819 14:90375463-90375485 AAGACTGATGAAGCCAGGCATGG - Intergenic
1121338123 14:93089503-93089525 ATGCCAGATGCCCACAGGCAGGG + Intronic
1121581331 14:95034333-95034355 AAGACAGATCTGGCCGGGCATGG - Intergenic
1121843207 14:97151648-97151670 AAGACAGATGTCACCAATCCAGG - Intergenic
1122169377 14:99859558-99859580 TAGCCAGGTGTCCACAGGCAAGG - Intronic
1122223272 14:100255827-100255849 AAGAGAGATGTCCACAAGTAGGG - Intronic
1122728634 14:103778243-103778265 AAGTCAGATGTGGCCAGGCGTGG - Intronic
1123105651 14:105839973-105839995 CAGTCAGATGTCCCCAGAGAGGG + Intergenic
1123456262 15:20429138-20429160 AAGATAGATTTGGCCAGGCACGG + Intergenic
1123661804 15:22571218-22571240 AAGATAGATTTGGCCAGGCACGG - Intergenic
1124066978 15:26353857-26353879 AAGACAGCTGTCCACACACAAGG - Intergenic
1124262405 15:28204329-28204351 AAGATAGATTTGGCCAGGCACGG + Intronic
1124315603 15:28665461-28665483 AAGATAGATTTGGCCAGGCACGG - Intergenic
1125973188 15:43928850-43928872 AAGATAAATGTCCTCAGGCTTGG - Intronic
1126236241 15:46388305-46388327 AAGACAAAAGTGGCCAGGCACGG + Intergenic
1128304581 15:66589575-66589597 TAAACAGTTGTCCCCAGGCATGG - Intronic
1128533106 15:68468650-68468672 AAGAAAGATGCCGCCAGGCATGG + Intergenic
1128630456 15:69260548-69260570 AAGCCAGTTGTGGCCAGGCACGG - Intronic
1129246139 15:74280124-74280146 AATACAGATCTCCTGAGGCATGG - Intronic
1129596376 15:76967519-76967541 AAGACAGGTTTCCCCCAGCATGG - Intergenic
1130052920 15:80498746-80498768 AAGGCAGATGTTCCCAGTCTGGG + Intronic
1130219292 15:82004801-82004823 AAGACAGATTAGGCCAGGCACGG - Intergenic
1130334074 15:82943781-82943803 GACAGAGATTTCCCCAGGCAGGG + Intronic
1130543321 15:84837708-84837730 AGGGCAGCTGTGCCCAGGCAAGG + Intronic
1130633033 15:85588383-85588405 AAGACACACGTACCCATGCAGGG - Intronic
1130968949 15:88717595-88717617 AAGACAAATATACCCAGCCAAGG - Intergenic
1131647056 15:94356005-94356027 AAAACAGTTTTCCCCAGGCAGGG + Intronic
1132048562 15:98587440-98587462 AAGACAGCTGGGGCCAGGCACGG + Intergenic
1132227248 15:100151778-100151800 TACACAGATGGCCACAGGCATGG + Intronic
1132861180 16:2072562-2072584 ACGTCAGAGGTCCCCAGCCAAGG + Intronic
1133115708 16:3576958-3576980 AAAAGAGATGTGGCCAGGCACGG - Intronic
1133976247 16:10601645-10601667 AAGCCAGCTGTCCCCAGGCTGGG - Intergenic
1134006679 16:10822693-10822715 AAGACAGATATCCCCAGCAGAGG - Intergenic
1134248054 16:12554697-12554719 AAGACAGCTGTCACCAGGCATGG - Intronic
1135570462 16:23545313-23545335 AAGTCAGCTGTTCCCAGGCCTGG - Intronic
1135921167 16:26650144-26650166 AAGGCACATGCCCCCAGGCCTGG - Intergenic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1136381585 16:29898547-29898569 AAGACAGATGAGCAGAGGCAGGG - Intronic
1137565129 16:49528041-49528063 AGGAGAGACGTCCCCAGGCTGGG + Intronic
1138104218 16:54278820-54278842 TTGTCAGATGTCCCCAGGGAGGG + Intergenic
1138862200 16:60772064-60772086 AAGAAAGATGCAGCCAGGCACGG + Intergenic
1139395137 16:66632790-66632812 AAAACAAATATCGCCAGGCACGG + Intronic
1139567668 16:67789317-67789339 AAAAAAAATGTACCCAGGCATGG + Intronic
1139636179 16:68259957-68259979 GGGACACATGGCCCCAGGCAGGG - Exonic
1140266066 16:73422256-73422278 AAGACAGATGACCCCATTCAAGG - Intergenic
1140276226 16:73511376-73511398 AAGACAGTTGGTGCCAGGCATGG + Intergenic
1140443701 16:75006724-75006746 AAGACTGAGGTGGCCAGGCACGG - Intronic
1140588216 16:76319826-76319848 AATCAAGATGTCCACAGGCAGGG - Intronic
1141693678 16:85610332-85610354 AAGAGAGCTGTGCCCAGGAAGGG + Intergenic
1141791576 16:86239696-86239718 AGGACAGCTGTCCCCAGGCCTGG - Intergenic
1141910011 16:87052543-87052565 AAGACAGAAATCTCCTGGCAAGG - Intergenic
1143203146 17:5125929-5125951 AATACAGAATTACCCAGGCATGG - Exonic
1143379023 17:6484245-6484267 AAGACAGAGGTTCCCAGCCCAGG - Exonic
1145183374 17:20772700-20772722 AAAACAAATGTGGCCAGGCATGG - Intergenic
1145835704 17:27952812-27952834 AAGAAAGAGCTCTCCAGGCAGGG + Intergenic
1146658836 17:34651381-34651403 GAAACAGATGCTCCCAGGCAGGG - Intergenic
1148202217 17:45756720-45756742 AAGACTGATGTTACCAGACAGGG - Intergenic
1148580733 17:48741844-48741866 AAAAAAAATGTACCCAGGCATGG - Intergenic
1150222151 17:63501685-63501707 AAGATAGAAATCCCCAGGCAGGG - Intronic
1151863602 17:76784597-76784619 AAGACAGTTATCCTCAGGCCGGG + Intergenic
1153869267 18:9301901-9301923 AAGAAAGATGTGGCCAGGCATGG + Intergenic
1155694478 18:28669066-28669088 AAGTCAGATTTCCCCAGTAAAGG + Intergenic
1156003364 18:32411091-32411113 AAAACCGAAGTCACCAGGCACGG - Intronic
1158128901 18:54131133-54131155 TAAACAATTGTCCCCAGGCAGGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1162370206 19:10274122-10274144 AGTACAGATGTCCCGGGGCAGGG - Intronic
1162568634 19:11458025-11458047 CAGCCAGATGGCCCCAGGCCGGG - Intronic
1162604347 19:11695165-11695187 AATGCAGATGTCCCCTGGGAGGG - Intergenic
1163497322 19:17654553-17654575 AACACAGCTGTCCCCAGCCCAGG + Intronic
1164619150 19:29683499-29683521 AAAACAAAAGTCCCAAGGCAGGG - Intergenic
1164722463 19:30442259-30442281 AAGCCAGATGGCTCCAGGGAGGG - Intronic
1165025562 19:32958724-32958746 AAGGCAAATGTGGCCAGGCATGG + Intronic
1165122245 19:33567630-33567652 AAGCTAGATGCCCCCTGGCAAGG + Intergenic
1165897044 19:39148240-39148262 AATAAAGATCTCGCCAGGCACGG - Intronic
1166537985 19:43587613-43587635 AATACCGATGACGCCAGGCACGG + Exonic
1167057452 19:47120989-47121011 AAAAAAAATGTCCCCAGGCTGGG - Intronic
1168588447 19:57613757-57613779 CAGAGAATTGTCCCCAGGCAGGG - Intergenic
1168606508 19:57764470-57764492 AAGACAGCTTTGGCCAGGCACGG + Intergenic
925253838 2:2465352-2465374 CAGGCAGCTGTCCCCAGGGACGG + Intergenic
927155429 2:20218454-20218476 AAGTCAGGAGTGCCCAGGCAAGG + Intronic
928184729 2:29100218-29100240 AAGTCAGTTGTGGCCAGGCATGG - Intronic
929508493 2:42547619-42547641 AAGACAAATGCCTCCAGGCGCGG - Intronic
929869148 2:45743620-45743642 TACACAGATGTGGCCAGGCAGGG - Intronic
930009017 2:46920803-46920825 AATACAAATATCCTCAGGCAGGG - Intronic
931939586 2:67237539-67237561 TTGACACATGTCCCCAGACAGGG + Intergenic
932471828 2:71964281-71964303 AAGCAAGATCTCCCCATGCAAGG + Intergenic
933733301 2:85474755-85474777 AACACAGAATTCCCCGGGCATGG - Intergenic
934066267 2:88344953-88344975 AACACAGGTGTCATCAGGCAGGG - Intergenic
937938405 2:127265135-127265157 AAAAAATATGGCCCCAGGCATGG - Intronic
938262624 2:129906398-129906420 AAGACCCATGTATCCAGGCAGGG - Intergenic
938405749 2:131032238-131032260 GGGACAGATGTCCCCAGGGCAGG + Intronic
939661064 2:144890355-144890377 AAGACAAATCTAACCAGGCATGG + Intergenic
940178828 2:150908980-150909002 AAGCCAGATGTCACCACGCAGGG + Intergenic
940832805 2:158486796-158486818 AAGACAGATCATCCCAAGCAAGG - Intronic
941743227 2:169058752-169058774 AAAACAGATGGACCCAGGGAGGG + Intergenic
945234052 2:207618131-207618153 AAGACAGTGGTCCCCAGCCTTGG + Intronic
945884428 2:215360092-215360114 AATACAAATGTTACCAGGCATGG - Intergenic
947795830 2:232893471-232893493 AAGACAGAAGTGCCGTGGCAGGG + Intronic
948754284 2:240150152-240150174 GAGATGGATGTCACCAGGCAGGG - Intergenic
948965548 2:241376808-241376830 AAGACAGACCTGCCCAGCCAGGG - Intronic
949060524 2:241953866-241953888 GAGCCAGATGTGCCCAGGCCGGG + Intergenic
1169394001 20:5213916-5213938 AAGACAGAGGTTCCAAGGTAAGG + Intergenic
1170717173 20:18842058-18842080 GAGAAGGTTGTCCCCAGGCACGG + Intergenic
1171188942 20:23144723-23144745 ATGGCAGAGGTTCCCAGGCAAGG - Intergenic
1171449962 20:25228631-25228653 AAGGCAAATGTGGCCAGGCATGG + Intergenic
1172237454 20:33387908-33387930 AATACAAAAGTACCCAGGCATGG + Intronic
1172319044 20:33982033-33982055 AATACAGATATCCCCAGCAATGG - Intergenic
1173626267 20:44475437-44475459 CAGACAGATGTCCCCTGGTTTGG + Intergenic
1173650130 20:44658306-44658328 AAGACAGAAGTGGCCAGGCGTGG - Intergenic
1174447247 20:50598337-50598359 AAGACAGAAATCTCCAGGGAGGG - Intronic
1175684464 20:61017547-61017569 AAGACTCATGTCACCAGGCCAGG - Intergenic
1176258854 20:64168489-64168511 AAGGCAGATGTACTCAGCCAGGG - Intronic
1176287918 21:5028620-5028642 AAGACTGAAGCCCCCAGACACGG + Intronic
1176431262 21:6577862-6577884 AACACAGAATTCTCCAGGCATGG - Intergenic
1177616888 21:23534357-23534379 AAGACAGATGACCATTGGCATGG - Intergenic
1179474463 21:41634347-41634369 AGGACTCATGGCCCCAGGCAGGG + Intergenic
1179706656 21:43185324-43185346 AACACAGAATTCTCCAGGCATGG - Intergenic
1179807270 21:43847644-43847666 AGGCCAGATGGCCCCAGGCAGGG + Intergenic
1179869263 21:44234855-44234877 AAGACTGAAGCCCCCAGACACGG - Intronic
1180594859 22:16966485-16966507 AAGACAGCAGCCCCCAGCCAAGG - Intronic
1181181998 22:21074929-21074951 GTGACTGATGTCCCCAGGCCTGG + Intergenic
1182101571 22:27661473-27661495 AAGCCAGATGCCGCCAGGCATGG + Intergenic
1183018693 22:35009999-35010021 CAGACAGAGGGCACCAGGCAAGG + Intergenic
1183781259 22:40000380-40000402 GATACAGATGCCCCCGGGCATGG + Intronic
1183786463 22:40031713-40031735 AAGGCAGGAGTGCCCAGGCAGGG + Exonic
1184753786 22:46504481-46504503 GAGACAGATGTCGCCAGGCTGGG - Intronic
1185104279 22:48858374-48858396 CAGAAAGATGGCCCCGGGCACGG - Intergenic
1185114372 22:48923174-48923196 AAGCCAGATGTGGCCAGGCGCGG - Intergenic
1185392816 22:50571796-50571818 AACACAGATGGCCCCAGGGGCGG + Intronic
949560778 3:5200220-5200242 AACATAAATGTACCCAGGCATGG - Intronic
950691686 3:14663560-14663582 AACAAAGCTTTCCCCAGGCAAGG - Intronic
950979675 3:17289057-17289079 AACACAGTGGTGCCCAGGCAGGG - Intronic
951865383 3:27301129-27301151 AGGCCAGGTGCCCCCAGGCAGGG + Intronic
953412386 3:42697716-42697738 CAGACAGGGCTCCCCAGGCAGGG - Intronic
953770120 3:45773160-45773182 AGGACAGATTTCCCCAGGACTGG + Intronic
953956661 3:47236719-47236741 AAGACAGGAGACCACAGGCAGGG + Intronic
954007715 3:47605479-47605501 AAGCCAGATGTGGCCGGGCATGG + Intronic
955829200 3:62983256-62983278 CAGACAGCTGGCCCCAGGGAGGG - Intergenic
958594251 3:96201396-96201418 TAGACTGATGTGCTCAGGCAAGG - Intergenic
959709681 3:109372763-109372785 AAGACAAAAGTCCACAGACATGG + Intergenic
960109796 3:113834643-113834665 AAGAGACATTTGCCCAGGCACGG + Intronic
961150266 3:124631893-124631915 AACACAAAGGTCCCAAGGCAAGG - Intronic
963728419 3:148947314-148947336 ATGACAGATATCACCAGGAAAGG + Intergenic
964938764 3:162128382-162128404 AAGACAGATTTCCTCAGGATAGG - Intergenic
965413980 3:168369170-168369192 AAGACATATGTCAGAAGGCAGGG - Intergenic
965493900 3:169374222-169374244 AAGACAGCTGTCTGCAAGCATGG + Intronic
965871641 3:173272067-173272089 TAAACAATTGTCCCCAGGCATGG - Intergenic
967207366 3:187136340-187136362 AAGAAAGATGTCATCAGGGAGGG - Intronic
967949161 3:194827312-194827334 AAGACAGATGCAGCCGGGCATGG - Intergenic
968295817 3:197575790-197575812 AAGACTGACTTCCCCAGGAAAGG + Intergenic
968377337 4:54175-54197 AAGACGGGTGTCCAGAGGCAGGG + Intronic
968384674 4:125373-125395 AAGACGGGTGTCCAGAGGCAGGG + Intronic
968393683 4:213511-213533 AAGACGGGTGTCCAGAGGCAGGG + Intergenic
968401770 4:304589-304611 AAGACGGGTGTCCAGAGGCAGGG - Intronic
968405896 4:338689-338711 AAGACGGGTGTCCAGAGGCAGGG + Intronic
968409109 4:371020-371042 AAAAAAGATGTGGCCAGGCATGG - Intronic
968410666 4:387011-387033 AAGACGGGTGTCCAGAGGCAGGG + Intergenic
968514029 4:1008970-1008992 AAGACAGAGGTGGCCAGGCAGGG - Intergenic
969227757 4:5810310-5810332 AGGACAGATGAACCCAGGCATGG - Intronic
969472498 4:7397560-7397582 AGGACAGATGTTCCCTGCCACGG + Intronic
969491543 4:7502057-7502079 CAGTCACATGTGCCCAGGCAGGG + Intronic
970877327 4:20886281-20886303 AAGGAACATGTCACCAGGCAGGG - Intronic
971371750 4:26024902-26024924 AAGAAAAATGTACCCAGGCCAGG - Intergenic
971573561 4:28245483-28245505 AAGCCAGGGGTCCCCAGTCACGG + Intergenic
971661217 4:29418408-29418430 AATACATATGTCACCAGGGATGG + Intergenic
974827310 4:67147994-67148016 ACAGCAGCTGTCCCCAGGCAAGG - Intergenic
975105488 4:70564134-70564156 GAGCCAGATGGCCCCAGGTAGGG + Intergenic
975827265 4:78332928-78332950 TAGACAGCTGTCCCAAGGGAGGG + Intronic
977423145 4:96828955-96828977 AACTCAGATGTTCCCAGGAAGGG + Intergenic
979814380 4:125082171-125082193 ATGACAGATGTTGCCAGGCATGG + Intergenic
981910112 4:149969417-149969439 AAGACACATGTTCCCTGGCCTGG + Intergenic
982430690 4:155318615-155318637 AAGACAGAAGGGGCCAGGCACGG - Intergenic
984913574 4:184699387-184699409 AAGACAAGTGTAACCAGGCACGG + Intronic
985564577 5:608946-608968 AAGACAGGAGTCCCCAGACCTGG - Intergenic
985993342 5:3581553-3581575 ATGATAGATATTCCCAGGCATGG + Intergenic
987647390 5:20691467-20691489 AAGGCAGATGTCCACAGGGCAGG - Intergenic
990254933 5:53957917-53957939 AAGACAAATGTGGCCAGGCATGG + Intronic
992089527 5:73304631-73304653 AAGGCAGAAGTCCTCAAGCATGG - Intergenic
992918507 5:81485799-81485821 AACACAAATGTGTCCAGGCATGG - Intronic
993379483 5:87190169-87190191 AAGACAAGTGTCCCCATGAAAGG + Intergenic
996117374 5:119633486-119633508 AAGACAGATTTCCTCAGCCCAGG + Intronic
996201957 5:120686372-120686394 AAGACAGATGTCCCCAGGCAGGG + Exonic
997596058 5:135108107-135108129 AAGACTGAGGTCCCCAGGCAGGG + Intronic
998262348 5:140641097-140641119 AAGACAGATGTCACAAGGGAAGG + Intronic
999414890 5:151386464-151386486 ATGACAGAAGTCACCAGGTAAGG - Intergenic
999512851 5:152270825-152270847 AAGACAATTTTCCCCAAGCAGGG - Intergenic
999622064 5:153483778-153483800 AGGTCATGTGTCCCCAGGCAAGG + Intergenic
1000462222 5:161536886-161536908 AAGTCATATATACCCAGGCATGG - Intronic
1000659560 5:163920714-163920736 AAGGCAGGTTTCCACAGGCATGG - Intergenic
1002041900 5:176520830-176520852 AAAACAGAAGAGCCCAGGCACGG + Intergenic
1002290029 5:178194182-178194204 AAGGCAGGGCTCCCCAGGCAGGG - Intergenic
1002632569 5:180591176-180591198 CAGACGGGTGTCCCCAGGCCAGG + Intronic
1003020610 6:2505722-2505744 AAGACATGTCTGCCCAGGCAGGG - Intergenic
1003213420 6:4088198-4088220 TAGACACATGTCCCCATCCATGG + Intronic
1003536446 6:6979750-6979772 AAGACAGCTGTCTGCAGGCCAGG - Intergenic
1003570897 6:7255872-7255894 AAAACAGAAGTCCCCAAGAATGG + Intergenic
1003614090 6:7639750-7639772 AAGACAGCTGTCCGCAGGCCAGG - Intergenic
1007192969 6:40035725-40035747 CAGACAGTTGTCCTCAGGCTTGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1012965190 6:105666415-105666437 CAGACTGATGTCTGCAGGCATGG + Intergenic
1014429506 6:121350959-121350981 AATACAGAGGTGGCCAGGCATGG + Intergenic
1016129101 6:140443340-140443362 AATACAGAAGTAGCCAGGCATGG + Intergenic
1017039116 6:150293700-150293722 GAGTCAGATGGCACCAGGCATGG - Intergenic
1018323362 6:162636964-162636986 AAAAAAGATGTGGCCAGGCATGG + Intronic
1019911311 7:4102043-4102065 AAGACAGAAGTCCCCAGGGAAGG + Intronic
1020188154 7:5974385-5974407 AAGACAGGTGGCACCAGGCGAGG + Intronic
1023513037 7:40973400-40973422 AAGCCAAAAGTCCCCAGGGAAGG - Intergenic
1026011326 7:66638729-66638751 AAGACAGATTTCCCGGGGAAGGG - Intronic
1026231828 7:68490535-68490557 AAAAGAGATGTGGCCAGGCACGG + Intergenic
1028372118 7:90104238-90104260 CAGACAGATGTGTCCAGCCAAGG + Intergenic
1028518281 7:91701279-91701301 AAGACAAAAGTGGCCAGGCACGG + Intronic
1028841806 7:95436573-95436595 TAAACAACTGTCCCCAGGCATGG - Intergenic
1029120614 7:98265504-98265526 AAGGCAGAAGTTGCCAGGCACGG + Intronic
1029745886 7:102515731-102515753 AAGGCAGAAGTCCCCACACATGG + Intronic
1029763824 7:102614710-102614732 AAGGCAGAAGTCCCCACACATGG + Intronic
1031514630 7:122686910-122686932 CAGACAGATGACCCGAGGCCAGG - Intronic
1032367499 7:131314284-131314306 AAGACAGAAGACCCCAGAAAGGG + Intronic
1033329284 7:140404678-140404700 AAGAAGGATGTCACAAGGCAGGG + Intronic
1033902994 7:146166247-146166269 AATACAAAAGTACCCAGGCATGG - Intronic
1034211813 7:149370333-149370355 AATACAGATGAGGCCAGGCATGG - Intergenic
1036504960 8:9346952-9346974 GAGGCAGCTGTCCCCAGGAATGG + Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1040432923 8:47361774-47361796 AAGACAGATGAGGGCAGGCAAGG + Intronic
1040811784 8:51461566-51461588 ATGGCAGAGGACCCCAGGCATGG - Intronic
1041058802 8:54016184-54016206 AAAACATATGTCGCCAGGCGCGG + Intronic
1042051399 8:64712368-64712390 TAGAAAGTTGTCCCTAGGCAGGG - Intronic
1042246736 8:66715541-66715563 AAGAAAGCTGTGGCCAGGCACGG - Intronic
1042548012 8:69968071-69968093 AATACAGAGGTCCCGAGGAAGGG - Intergenic
1043144529 8:76636435-76636457 AAGACAGAGATGGCCAGGCATGG + Intergenic
1044054580 8:87552810-87552832 ATTACATATGTACCCAGGCAGGG - Intronic
1046707302 8:117469220-117469242 CAGAAACATATCCCCAGGCAAGG - Intergenic
1046941395 8:119934802-119934824 AAGCCACATGCCCCAAGGCATGG - Intronic
1047446331 8:124923461-124923483 AAAACAGATGTGCTTAGGCATGG + Intergenic
1047864579 8:129008394-129008416 AAGATATATGTGGCCAGGCATGG + Intergenic
1048525847 8:135201768-135201790 CAGAAAGATGTCCCCTGGCCAGG - Intergenic
1049230634 8:141479507-141479529 AAGCCGGGTGTCCCCTGGCATGG - Intergenic
1050911807 9:11080788-11080810 TATACAGATGTTGCCAGGCATGG - Intergenic
1051923067 9:22290615-22290637 AAGATAGATGTCCCAACTCAAGG + Intergenic
1052970704 9:34375795-34375817 AAGACAGAAGCCCACAGGCCTGG + Intronic
1054805583 9:69393449-69393471 AACAGAGCTGACCCCAGGCAAGG - Intergenic
1055037718 9:71836191-71836213 AAGAAAGAGGTAGCCAGGCATGG - Intergenic
1056562367 9:87742804-87742826 AAGGCAGTAGTCCCCAGGCAAGG - Intergenic
1059352037 9:113672412-113672434 AAGACTGAGGTCCCCAGGAGAGG + Intergenic
1061407862 9:130402737-130402759 AGGACAGAGGTCCCCAGGGATGG - Intronic
1061496510 9:130977892-130977914 AAGTCAGCTGGCCCCAGGGATGG + Intergenic
1061831056 9:133295141-133295163 AAGACAAATGCCACCAGGCGTGG + Intergenic
1062057926 9:134478243-134478265 AGGACAGGTCTCCCCAGGGATGG - Intergenic
1203562889 Un_KI270744v1:73119-73141 GTGACAGATGTCCCATGGCAGGG - Intergenic
1203571899 Un_KI270744v1:140071-140093 AAGACGGGTGTCCAGAGGCAGGG - Intergenic
1186115503 X:6301318-6301340 AAGACAGCTGTCTGCAGGCCAGG - Intergenic
1186682969 X:11895280-11895302 AACAAAGATGTTTCCAGGCATGG + Intergenic
1187710941 X:22053697-22053719 AAGACAGATGACTCAAGGTACGG + Intronic
1188533531 X:31168666-31168688 CAGACAGATGCCACCAAGCAAGG - Intronic
1188581653 X:31721422-31721444 AAGACTGAAGTCCCCAGAAAAGG + Intronic
1189820635 X:44867281-44867303 AAGACAGATATTCCCACACAAGG - Intergenic
1192751201 X:73993581-73993603 AAGACAGATCTCCTCCTGCAAGG - Intergenic
1194449936 X:94032245-94032267 AAAACAGATGAGGCCAGGCACGG + Intergenic
1194758583 X:97766917-97766939 AAGACAAATGGCGCCAGACATGG + Intergenic
1195285173 X:103376735-103376757 AACACAGAGGCCCCCAGGGATGG + Intronic
1197294491 X:124701474-124701496 AAGACAGATGACCATATGCAAGG - Intronic
1197709864 X:129657993-129658015 AAAACAGATGTGGCCAGGCATGG - Intergenic
1199589932 X:149457913-149457935 AATACAGATCTCCCCATGAAAGG + Intergenic
1199749778 X:150804454-150804476 AACAAAGATCTCTCCAGGCACGG + Intronic
1200887506 Y:8283693-8283715 AAAACAGATGAGGCCAGGCATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201686551 Y:16710889-16710911 AAGACACATGTTCCCAAGGAGGG + Intergenic