ID: 996202510

View in Genome Browser
Species Human (GRCh38)
Location 5:120694050-120694072
Sequence CCTGCCAACATGTTGTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996202503_996202510 17 Left 996202503 5:120694010-120694032 CCTAACAATTTCGCCTGTATTCC No data
Right 996202510 5:120694050-120694072 CCTGCCAACATGTTGTTATGAGG No data
996202500_996202510 28 Left 996202500 5:120693999-120694021 CCACCCAGTTTCCTAACAATTTC No data
Right 996202510 5:120694050-120694072 CCTGCCAACATGTTGTTATGAGG No data
996202502_996202510 24 Left 996202502 5:120694003-120694025 CCAGTTTCCTAACAATTTCGCCT No data
Right 996202510 5:120694050-120694072 CCTGCCAACATGTTGTTATGAGG No data
996202501_996202510 25 Left 996202501 5:120694002-120694024 CCCAGTTTCCTAACAATTTCGCC No data
Right 996202510 5:120694050-120694072 CCTGCCAACATGTTGTTATGAGG No data
996202506_996202510 -4 Left 996202506 5:120694031-120694053 CCTCCTTTGAAGGACACCACCTG No data
Right 996202510 5:120694050-120694072 CCTGCCAACATGTTGTTATGAGG No data
996202507_996202510 -7 Left 996202507 5:120694034-120694056 CCTTTGAAGGACACCACCTGCCA No data
Right 996202510 5:120694050-120694072 CCTGCCAACATGTTGTTATGAGG No data
996202505_996202510 4 Left 996202505 5:120694023-120694045 CCTGTATTCCTCCTTTGAAGGAC No data
Right 996202510 5:120694050-120694072 CCTGCCAACATGTTGTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996202510 Original CRISPR CCTGCCAACATGTTGTTATG AGG Intergenic
No off target data available for this crispr