ID: 996204137

View in Genome Browser
Species Human (GRCh38)
Location 5:120710253-120710275
Sequence CATAGCTCCAGGGGTACAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996204133_996204137 21 Left 996204133 5:120710209-120710231 CCTGATGACTTTGCATTTCTCTG No data
Right 996204137 5:120710253-120710275 CATAGCTCCAGGGGTACAACCGG No data
996204132_996204137 22 Left 996204132 5:120710208-120710230 CCCTGATGACTTTGCATTTCTCT No data
Right 996204137 5:120710253-120710275 CATAGCTCCAGGGGTACAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996204137 Original CRISPR CATAGCTCCAGGGGTACAAC CGG Intergenic
No off target data available for this crispr