ID: 996206502

View in Genome Browser
Species Human (GRCh38)
Location 5:120744391-120744413
Sequence GGTTGGAAGGGGATTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996206491_996206502 4 Left 996206491 5:120744364-120744386 CCATGTCTCAATCTTTCAGTTCC No data
Right 996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG No data
996206490_996206502 22 Left 996206490 5:120744346-120744368 CCAGTTGTCTGGCGCAGGCCATG No data
Right 996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996206502 Original CRISPR GGTTGGAAGGGGATTGGGGA AGG Intergenic
No off target data available for this crispr