ID: 996206714

View in Genome Browser
Species Human (GRCh38)
Location 5:120746912-120746934
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996206714_996206715 -7 Left 996206714 5:120746912-120746934 CCAACATAGTTATTGGATAAAAT No data
Right 996206715 5:120746928-120746950 ATAAAATCATCTTTCTTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996206714 Original CRISPR ATTTTATCCAATAACTATGT TGG (reversed) Intergenic
No off target data available for this crispr