ID: 996210140

View in Genome Browser
Species Human (GRCh38)
Location 5:120798458-120798480
Sequence CCTACCAGGTAGCACATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996210134_996210140 -5 Left 996210134 5:120798440-120798462 CCTGAAATAACCAACAGCCCTAC No data
Right 996210140 5:120798458-120798480 CCTACCAGGTAGCACATTGTGGG No data
996210133_996210140 2 Left 996210133 5:120798433-120798455 CCTTGGGCCTGAAATAACCAACA No data
Right 996210140 5:120798458-120798480 CCTACCAGGTAGCACATTGTGGG No data
996210132_996210140 3 Left 996210132 5:120798432-120798454 CCCTTGGGCCTGAAATAACCAAC No data
Right 996210140 5:120798458-120798480 CCTACCAGGTAGCACATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996210140 Original CRISPR CCTACCAGGTAGCACATTGT GGG Intergenic
No off target data available for this crispr