ID: 996214507

View in Genome Browser
Species Human (GRCh38)
Location 5:120850347-120850369
Sequence CTGGGGAGGGTGAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996214497_996214507 7 Left 996214497 5:120850317-120850339 CCTGGTGGCACACACTTGTTGTC No data
Right 996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG No data
996214496_996214507 12 Left 996214496 5:120850312-120850334 CCTAGCCTGGTGGCACACACTTG No data
Right 996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996214507 Original CRISPR CTGGGGAGGGTGAGGCAGGA GGG Intergenic
No off target data available for this crispr