ID: 996217768

View in Genome Browser
Species Human (GRCh38)
Location 5:120890177-120890199
Sequence CAAGCTTCCCAGATTGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996217768_996217771 20 Left 996217768 5:120890177-120890199 CCTAGTTCAATCTGGGAAGCTTG No data
Right 996217771 5:120890220-120890242 TCACCTAGATTTTTTAGTTTGGG No data
996217768_996217770 19 Left 996217768 5:120890177-120890199 CCTAGTTCAATCTGGGAAGCTTG No data
Right 996217770 5:120890219-120890241 TTCACCTAGATTTTTTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996217768 Original CRISPR CAAGCTTCCCAGATTGAACT AGG (reversed) Intergenic
No off target data available for this crispr