ID: 996218578

View in Genome Browser
Species Human (GRCh38)
Location 5:120899269-120899291
Sequence ATTTATATGCACAAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996218573_996218578 30 Left 996218573 5:120899216-120899238 CCCTCTGTCTTAAAGATGCCAAG No data
Right 996218578 5:120899269-120899291 ATTTATATGCACAAGAAGGCAGG No data
996218576_996218578 12 Left 996218576 5:120899234-120899256 CCAAGAAGCTTAACTATGGCAAA No data
Right 996218578 5:120899269-120899291 ATTTATATGCACAAGAAGGCAGG No data
996218574_996218578 29 Left 996218574 5:120899217-120899239 CCTCTGTCTTAAAGATGCCAAGA No data
Right 996218578 5:120899269-120899291 ATTTATATGCACAAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996218578 Original CRISPR ATTTATATGCACAAGAAGGC AGG Intergenic
No off target data available for this crispr