ID: 996228762

View in Genome Browser
Species Human (GRCh38)
Location 5:121034524-121034546
Sequence CTCTGGGTCTCTAGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996228757_996228762 15 Left 996228757 5:121034486-121034508 CCAACAGTAGCAGTATGAACTCA No data
Right 996228762 5:121034524-121034546 CTCTGGGTCTCTAGGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996228762 Original CRISPR CTCTGGGTCTCTAGGAAAGA TGG Intergenic
No off target data available for this crispr