ID: 996230490

View in Genome Browser
Species Human (GRCh38)
Location 5:121058022-121058044
Sequence TGGGATTACAGGTGAATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996230484_996230490 -4 Left 996230484 5:121058003-121058025 CCTTAGCCTCCCAAGTAGCTGGG 0: 3284
1: 97219
2: 208854
3: 252558
4: 348731
Right 996230490 5:121058022-121058044 TGGGATTACAGGTGAATTACAGG No data
996230479_996230490 25 Left 996230479 5:121057974-121057996 CCGCCTCCTGGGTTCAAGTGATC 0: 378
1: 15580
2: 44799
3: 82626
4: 112660
Right 996230490 5:121058022-121058044 TGGGATTACAGGTGAATTACAGG No data
996230486_996230490 -10 Left 996230486 5:121058009-121058031 CCTCCCAAGTAGCTGGGATTACA 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
Right 996230490 5:121058022-121058044 TGGGATTACAGGTGAATTACAGG No data
996230481_996230490 19 Left 996230481 5:121057980-121058002 CCTGGGTTCAAGTGATCCTAATG No data
Right 996230490 5:121058022-121058044 TGGGATTACAGGTGAATTACAGG No data
996230482_996230490 3 Left 996230482 5:121057996-121058018 CCTAATGCCTTAGCCTCCCAAGT No data
Right 996230490 5:121058022-121058044 TGGGATTACAGGTGAATTACAGG No data
996230480_996230490 22 Left 996230480 5:121057977-121057999 CCTCCTGGGTTCAAGTGATCCTA 0: 5
1: 1281
2: 32349
3: 85062
4: 146967
Right 996230490 5:121058022-121058044 TGGGATTACAGGTGAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996230490 Original CRISPR TGGGATTACAGGTGAATTAC AGG Intergenic
No off target data available for this crispr