ID: 996232112

View in Genome Browser
Species Human (GRCh38)
Location 5:121078451-121078473
Sequence CCATTCCCACAGACTTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996232105_996232112 29 Left 996232105 5:121078399-121078421 CCTTGCTATGATGGAAGCGGCAG No data
Right 996232112 5:121078451-121078473 CCATTCCCACAGACTTCTGAAGG No data
996232110_996232112 -6 Left 996232110 5:121078434-121078456 CCAGAAATCACTGGAGACCATTC No data
Right 996232112 5:121078451-121078473 CCATTCCCACAGACTTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996232112 Original CRISPR CCATTCCCACAGACTTCTGA AGG Intergenic
No off target data available for this crispr