ID: 996241982

View in Genome Browser
Species Human (GRCh38)
Location 5:121215363-121215385
Sequence TAGGATACACAAGCACAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996241982_996241984 -9 Left 996241982 5:121215363-121215385 CCTTGTTGTGCTTGTGTATCCTA No data
Right 996241984 5:121215377-121215399 TGTATCCTATCCTGGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996241982 Original CRISPR TAGGATACACAAGCACAACA AGG (reversed) Intergenic
No off target data available for this crispr