ID: 996245915

View in Genome Browser
Species Human (GRCh38)
Location 5:121263630-121263652
Sequence CAGTTGGAGGAGAGTGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996245909_996245915 3 Left 996245909 5:121263604-121263626 CCTGTAAAGTGGCACTGGAGAGG No data
Right 996245915 5:121263630-121263652 CAGTTGGAGGAGAGTGCGGGTGG No data
996245908_996245915 7 Left 996245908 5:121263600-121263622 CCTACCTGTAAAGTGGCACTGGA No data
Right 996245915 5:121263630-121263652 CAGTTGGAGGAGAGTGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996245915 Original CRISPR CAGTTGGAGGAGAGTGCGGG TGG Intergenic
No off target data available for this crispr