ID: 996248559

View in Genome Browser
Species Human (GRCh38)
Location 5:121297229-121297251
Sequence GACCCGCATCGTGGTCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996248549_996248559 17 Left 996248549 5:121297189-121297211 CCCAGTCCTTTTTCTGCCCTCTC No data
Right 996248559 5:121297229-121297251 GACCCGCATCGTGGTCTTAGGGG No data
996248550_996248559 16 Left 996248550 5:121297190-121297212 CCAGTCCTTTTTCTGCCCTCTCC No data
Right 996248559 5:121297229-121297251 GACCCGCATCGTGGTCTTAGGGG No data
996248551_996248559 11 Left 996248551 5:121297195-121297217 CCTTTTTCTGCCCTCTCCCTTTC No data
Right 996248559 5:121297229-121297251 GACCCGCATCGTGGTCTTAGGGG No data
996248552_996248559 1 Left 996248552 5:121297205-121297227 CCCTCTCCCTTTCTACATTTGTC No data
Right 996248559 5:121297229-121297251 GACCCGCATCGTGGTCTTAGGGG No data
996248555_996248559 -6 Left 996248555 5:121297212-121297234 CCTTTCTACATTTGTCAGACCCG No data
Right 996248559 5:121297229-121297251 GACCCGCATCGTGGTCTTAGGGG No data
996248553_996248559 0 Left 996248553 5:121297206-121297228 CCTCTCCCTTTCTACATTTGTCA No data
Right 996248559 5:121297229-121297251 GACCCGCATCGTGGTCTTAGGGG No data
996248554_996248559 -5 Left 996248554 5:121297211-121297233 CCCTTTCTACATTTGTCAGACCC No data
Right 996248559 5:121297229-121297251 GACCCGCATCGTGGTCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996248559 Original CRISPR GACCCGCATCGTGGTCTTAG GGG Intergenic
No off target data available for this crispr