ID: 996250939

View in Genome Browser
Species Human (GRCh38)
Location 5:121331294-121331316
Sequence CTTTATTAGCAGAATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996250937_996250939 -6 Left 996250937 5:121331277-121331299 CCCAGTCTTGAGTATGTCTTTAT 0: 188
1: 2587
2: 4576
3: 7774
4: 9067
Right 996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG No data
996250938_996250939 -7 Left 996250938 5:121331278-121331300 CCAGTCTTGAGTATGTCTTTATT 0: 83
1: 1157
2: 3381
3: 5685
4: 7614
Right 996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG No data
996250935_996250939 26 Left 996250935 5:121331245-121331267 CCTTTATAAAAAACTCTTTCCTT No data
Right 996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG No data
996250936_996250939 7 Left 996250936 5:121331264-121331286 CCTTTATAAATTACCCAGTCTTG 0: 1394
1: 2501
2: 4118
3: 3674
4: 2254
Right 996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996250939 Original CRISPR CTTTATTAGCAGAATGAGAA TGG Intergenic
No off target data available for this crispr