ID: 996265480

View in Genome Browser
Species Human (GRCh38)
Location 5:121534691-121534713
Sequence GGTGCTCACTAACCCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996265480_996265486 15 Left 996265480 5:121534691-121534713 CCTGCATGGGGTTAGTGAGCACC No data
Right 996265486 5:121534729-121534751 CTTGAAGAGCTCTTGAGAAAGGG No data
996265480_996265487 16 Left 996265480 5:121534691-121534713 CCTGCATGGGGTTAGTGAGCACC No data
Right 996265487 5:121534730-121534752 TTGAAGAGCTCTTGAGAAAGGGG No data
996265480_996265490 29 Left 996265480 5:121534691-121534713 CCTGCATGGGGTTAGTGAGCACC No data
Right 996265490 5:121534743-121534765 GAGAAAGGGGTGGGTCAAATAGG No data
996265480_996265488 19 Left 996265480 5:121534691-121534713 CCTGCATGGGGTTAGTGAGCACC No data
Right 996265488 5:121534733-121534755 AAGAGCTCTTGAGAAAGGGGTGG No data
996265480_996265489 20 Left 996265480 5:121534691-121534713 CCTGCATGGGGTTAGTGAGCACC No data
Right 996265489 5:121534734-121534756 AGAGCTCTTGAGAAAGGGGTGGG No data
996265480_996265485 14 Left 996265480 5:121534691-121534713 CCTGCATGGGGTTAGTGAGCACC No data
Right 996265485 5:121534728-121534750 CCTTGAAGAGCTCTTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996265480 Original CRISPR GGTGCTCACTAACCCCATGC AGG (reversed) Intergenic
No off target data available for this crispr