ID: 996266003

View in Genome Browser
Species Human (GRCh38)
Location 5:121541119-121541141
Sequence GATGCTGGAGAGCCTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996265996_996266003 25 Left 996265996 5:121541071-121541093 CCTAGGTTGTTCAAGAATTGTCT No data
Right 996266003 5:121541119-121541141 GATGCTGGAGAGCCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996266003 Original CRISPR GATGCTGGAGAGCCTCAGGA AGG Intergenic
No off target data available for this crispr