ID: 996266642

View in Genome Browser
Species Human (GRCh38)
Location 5:121549221-121549243
Sequence CTGAATTAGTGGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996266642_996266645 7 Left 996266642 5:121549221-121549243 CCTTCTTTCCTCCACTAATTCAG No data
Right 996266645 5:121549251-121549273 TCAATGCTAGCTCACTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996266642 Original CRISPR CTGAATTAGTGGAGGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr